text stringlengths 1 2.15M | meta dict |
|---|---|
Q:
How do I use the "Barbara, Celarent, … etc." mnemonic?
Medieval logicians memorized this most famous logic mnemonic:
Barbara, Celarent, Darii, Ferio ← direct first figure
Baralipton, Celantes, Dabitis, Fapesmo, Frisesomorum ← indirect first figure
Cesare, Camestres, Festino, Baroco ← second figure
Darapti, Felapton, Disamis, Datisi, Bocardo, Ferison ← third figure
The 3 vowels of each name tell what the major, minor, and conclusion are; each vowel corresponds to one of 4 possibilities from the square of opposition:
So Barbara is an AAA syllogism, e.g.:
Every man is an animal.
Every animal is a creature.
∴ Every man is a creature.
There is more to the mnemonic than this. Apparently the consonants in the names allow one to reduce the corresponding syllogism to that of a simpler figure.
Are there any references that overview how to fully use all that is packed into this very elaborate, well-thought-out mnemonic?
A:
A good introduction is the second volume of Gabbay & Woods (2008), Handbook of the History of Logic, where you'll find the mnemonics explained on pp 331ff. The mnemonics themselves seems to have originated in 13th century textbooks. For the original, see: de Rijk (1967), Logica Modernorum, vol 2, pp 362ff. I would also recommend Kretzmann, Kenny & Pinborg's Cambridge History of Later Medieval Philosophy: Together with Gabbay this will give you a couple of hundred pages on the development of mediaeval logic, but it will also show you that it was rather more sophisticated than just an mnemonic which you could apply blindly. For even more detail see: Parry & Hacker (1991), Aristotelian Logic, which seems to give a very comprehensive exposition (I have only skimmed this, though).
Unlike @jobermark, I find classical logic an endlessly fascinating topic (I am in no way an expert, though). The value in studying it? Partly seeing the development of an extremly sophisticated system over hundreds of years, partly experiencing the strain between the formal system and that which it is trying to formalize. I would not, however, recommend it as an alternative to modern logic; much less as a guide on how to think. For a very readable comparison with modern logic, see Jan Lukasiewicz (1957), Aristotle's Syllogistic from the Standpoint of Modern Formal Logic. And while you will often find a very polemical stance in 19th and 20th century philosophy, Karl Menger, »The New Logic« (in Sarkar (1996): Logical Empirism at its Peak) presents a rather nuanced motivation for modern logic.
A:
Explanation of the Mnemonic
Brody, Boruch A. "Logical Terms, Glossary of." Encyclopedia of Philosophy. Ed. Donald M. Borchert. 2nd ed. Vol. 5. Detroit: Macmillan Reference USA, 2006. 533-560. Gale Virtual Reference Library. Web. 19 May 2016.:
mnemonic terms
The names that the medieval logicians introduced for the valid syllogisms. One such term is "Barbara." The key for these mnemonics is as follows: The three vowels respectively indicate the three constituent propositions of the syllogism as A, E, I, or O. For first-figure syllogisms the initial consonants are arbitrarily the first four consonants; for the other figures the initial consonants indicate to which of the first-figure syllogisms the syllogism in question may be reduced. Other consonants occurring in second-, third-, and fourth-figure mnemonics indicate the operation that must be performed on the proposition indicated by the preceding vowel in order to reduce the syllogism to a first-figure syllogism. The key for this is as follows: "s" indicates simple conversion, "p" indicates conversion per accidens, "m" indicates metathesis (interchanging of the premises), "k" indicates obversion, and "c" indicates convertio syllogism (that is, the syllogism is to be reduced indirectly). In mnemonic terms the only meaningless letters are "r," "t," "l," "n," and noninitial "b" and "d." More elaborate mnemonics have been devised for syllogisms in which two or more of the premises exhibit modality. See entry "Logic, Traditional."
Mnemonic Terms
Name Figure Major Minor Conclusion
premise premise
Barbara first A A A
Baroco second A O O
Bocardo third O A O
Bramantip fourth A A I
Camenes fourth A E E
Camestres second A E E
Celarent first E A E
Cesare second E A E
Darapti third A A I
Darii first A I I
Datisi third A I I
Dimaris fourth I A I
Disamis third I A I
Felapton third E A O
Ferio first E I O
Ferison third E I O
Fesapo fourth E A O
Festino second E I O
Fresison fourth E I O
Reduction
So, what are the different types of reduction mentioned above?
simple conversion
conversion per accidens
metathesis (interchanging the premises)
obversion
convertio syllogism (indirect conversion)
reduction of syllogisms
The process whereby syllogisms in imperfect figures are expressed in the first figure. Reduction is direct when the original conclusion follows from premises in the first figure derived by conversion, obversion, etc., from premises in an imperfect figure. Reduction is indirect when a new syllogism is formed which establishes the validity of the original conclusion by showing the illegitimacy of its contradictory. See entry "Logic, Traditional."
conversion
In traditional logic, a type of immediate inference in which from a given proposition another proposition is inferred that has as its subject the predicate of the original proposition and as its predicate the subject of the original proposition (the quality of the proposition being retained). The process of conversion yields an equivalent proposition only when the original proposition is an E- or I-proposition; when it is an A-proposition traditional logicians allowed for conversion per accidens (or by limitation)—that is, conversion plus a change in the quantity of the proposition from universal to particular. Thus, the E-proposition "No men are immortal" yields "No immortals are men," but the A-proposition "All men are mortal" can be converted only by limitation, yielding "Some mortals are men." The process of conversion yields no equivalent proposition if the original proposition is an O-proposition. See entry "Logic, Traditional."
obversion
In traditional logic, a type of immediate inference in which from a given proposition another proposition is inferred whose subject is the same as the original subject, whose predicate is the contradictory of the original predicate, and whose quality is affirmative if the original proposition's quality was negative and vice versa. Obversion of a proposition yields an equivalent proposition when applied to all four types (A, E, I, and O) of propositions that traditional logicians considered. See entry "Logic, Traditional."
| {
"pile_set_name": "StackExchange"
} |
Welcome to QPR REPORT - A completely unofficial and unaffiliated fan site focusing on G-d's Chosen Team, Queen's Park Rangers (QPR) FC. (Visit also QPR Report Messageboard and Follow on Twitter.) QPR Report accepts no sponsorship, advertising or financial contributions. In 2008, QPR Report was named as one of the top two blogs in the Football League
QPR Report Twitter Feed
Thursday, February 25, 2010
QPR Report Snippets Thursday
- For comprehensive and latest QPR news-related pieces and discussion, visit the football-only, somewhat-different QPR Report Messageboard. All QPR Perspectives genuinely welcomed! Or comment on any of the articles posted below
WARNOCK POST ASTON-VILLA GAME COMMENTSWarnock coy over Palace futurePublished: Wednesday, 24 February 2010, 11:33PMCrystal Palace manager Neil Warnock again made little comment about his future after the 3-1 FA Cup defeat at Aston Villa amid speculation he is bound for QPR. Warnock did confirm that he will be in charge of Palace for Saturday's game at Doncaster but the former Sheffield United boss was giving very little away. He said: "This could have been my last game - but it won't be and we'll now get ready for Doncaster. "Can I deny speculation about going to QPR? No." ITV
Crystal Palace manager Neil Warnock insists the FA Cup defeat to Aston Villa will not be his last game in charge.
The financially-stricken Eagles went down 3-1 at Villa Park, although they put in a spirited display and equalised in the second half thanks to a Darren Ambrose penalty.
With Warnock continually linked with a move to Queens Park Rangers, it had been rumoured that the fifth-round replay would be his last as Palace boss.
However, while not denying the Rangers link, he says he will still be at the helm for the Doncaster clash at the weekend.- "This could have been my last game, but it won't be and we'll now get ready for Doncaster," he said.- "Can I deny speculation about going to QPR? No."...."Skysports
BBC/Steve Claridge re Neil Warnock, Crystal Palace and QPR - Ask Steve Claridge Crystal Palace have slipped into the Championship relegation zone since going into administration and being docked 10 points at the end of January and their manager Neil Warnock is being heavily linked with a move to QPR. This week I examine the Eagles' prospects, as well as those of Warnock should he decide to leave Selhurst Park to take the reins at Loftus Road....
- Do you think Crystal Palace can hold on to manager Neil Warnock and can they stay in the Championship?Steve Bidwell, England
There is lots of speculation at the moment that Warnock will be taking charge at QPR next week, which is ironic considering he could have been sacked by Palace earlier on in the season because he had an absolute nightmare start. The reason he kept his job was that he has a very good relationship with Simon Jordan, Palace's former owner, but that tie is no longer there.
I understand the appeal of changing jobs. Palace are in a precarious state after going into administration while, at QPR, they finally look like they are getting back to some sort of sanity.
So I can see Warnock going to QPR but I think it will only be under his own terms. I don't know how long he is planning to stay in the game so it might be his last hurrah if they were to give him some dough and let him make a real go of it.
If Warnock does go to Loftus Road, and it looks like he will, then Palace are in trouble. Whoever replaces him will face a difficult job to keep them up and, in the longer term, a lot will depend on where they are when they come out of administration and who owns them.Warnock is being linked with the manager's job at QPR But the biggest problem Palace have is their ground. They need to agree a decent lease or acquire Selhurst Park themselves because, if the situation continues where they are told how much they have to pay for the rent of their ground, then it will hold them back forever. Whoever takes over the club will have to resolve that as quickly as possible. BBC
QPR Official Site - AMIT Q&A ON QPR PLAYER!From season ticket prices to why he isn't the new Chairman, from improving communication with the fans to dealing with poor attendances, QPR Holdings Ltd Vice Chairman Amit Bhatia has spoken exclusively to QPR PLAYER regarding the issues which are most important to YOU!
Amit on new Chairman Ishan Saksena...- "The biggest change since the restructuring is that Ishan is now the Chairman of QPR.- "I believe he has a set of instructions and a vision for how decisions are made and how the Club should be, as well as the stability and security that should come with running a Football Club."About the new man in control...- "Ishan is somebody that I have known for a very long time, and who I have an awful amount of trust in.- "I believe that QPR needs someone who is full-time, aware to its needs and has 100 per cent commitment. It was the best decision therefore to appoint Ishan."- On taking the Club forward...- "Our vision as a family is to reintroduce stability into the Football Club. It's of great importance. An organisation cannot succeed if there's no stability at the top.- "By empowering the right people and by doing the right things we will achieve great success." To hear much more from Amit, tune into QPR Player later today where you will find the first of our three-part exclusive interview with the QPR Vice Chairman. Not registered to QPR Player? Click here to join for less than 10p a day! - QPR | {
"pile_set_name": "Pile-CC"
} |
How have Stan Lee's ideas about superpowers changed as he's gotten older? In this sketch from Key & Peele, the Marvel Comics creator pitches several new characters based on his more recent frustrations and desires. »11/15/14 11:00am 11/15/14 11:00am
What do you get as a present for Stan Lee, the man who has a cameo in every Marvel movie? How about a sculpture of his face fashioned into a cameo jewel? Someone commissioned this Stan Lee cameo as a gift for Lee and you can buy one for yourself. »10/28/14 7:00pm 10/28/14 7:00pm
There's a rumor going around that Stan Lee, who has managed to cameo in almost every Marvel movie including those made by Sony and Fox, is not just playing random characters but is instead Uatu, the cosmic alien known as The Watcher. This rumor is dumb, and this compilation of Lee's cameos proves why. »10/03/14 1:20pm 10/03/14 1:20pm
Updated! Apparently Disney didn't forbid the scene, because they never saw it. Director James Gunn took to Instagram to clear up the story. It boils down to this: He shot it with a double (seen in the pic below) but before the real Stan could film it, decided it was too similar to Star-Lord's finger gag. Good call! »9/02/14 6:42am 9/02/14 6:42am
In 1963, George R. Martin (who, at that age, had yet to earn his second "R") wrote to Stan Lee and Jack Kirby in feigned praise of Fantastic Four #17, an issue he refers to, dryly, as "greater than great... absolutely stupendous, the ultimate, utmost!" Proving that even as a boy, GRRM was an acerbic, 65-year-old man. »6/15/14 3:00pm 6/15/14 3:00pm
We've seen numerous western superheroes drawn in the styles of Japanese manga artists, but what if famous Japanese characters had been designed by American artists? Jack Kirby's take on Akira might have been an American version worth looking at. »3/28/14 11:40am 3/28/14 11:40am
Three new clips from Amazing Spider-Man 2 have just dropped, complete with narration by Stan Lee. They're also complete with a pretty major spoiler for the movie if you're interested (it's in the last video below). »3/07/14 11:40am 3/07/14 11:40am
If the world seems a little grayer today, if children seem to laugh less, or if puppies and kittens look a little less cute, please don't be confused. This is merely the consequence of the devastating news that Stan Lee will somehow not have a cameo in Marvel's upcoming Guardians of the Galaxy film. »1/22/14 9:45am 1/22/14 9:45am
Playing "spot the Stan Lee cameo" is a tradition when watching Marvel movies, but in an upcoming episode of Agents of S.H.I.E.L.D., he'll be getting more than a brief shot and a quippy line. »1/07/14 10:39am 1/07/14 10:39am
Could Stephen King's The Stand become a movie at last? Stan Lee's working on a movie for Sony, details have emerged about the in-development Agent Carter series, and someone we know well is getting shot by Oliver on Arrow. Plus, there's a rumor CBS is working on two Star Trek series — but what are they about? Spoilers… »11/28/13 6:00am 11/28/13 6:00am
No one likes to think about it but there will be a day when Stan Lee’s cameos will end. He may be an indefatigable 90-year-old but the co-creator of The Fantastic Four, Hulk and Spider-Man is still only human. But, in the upcoming Lego Marvel Super-Heroes video game, Stan Lee is pretty much omnipotent. »9/10/13 4:02pm 9/10/13 4:02pm
This week in the world of cartoons, Bender is robo-jacked on Futurama, Stan Lee voices a janitor on Ultimate Spider-Man, and we are treated to the spectacular Gravity Falls season finale. »8/03/13 7:00am 8/03/13 7:00am
JADS international, makers of fine colognes inspired by the Avengers, has lost their fucking minds is releasing a cologne based on Stan Lee. The scent is called 'Nuff Said. I am not making this up. »6/12/13 3:00pm 6/12/13 3:00pm
Stan Lee has done plenty in his 90 years on this planet Earth, but now you can add "parkour master" to his titles of "creator of some of the greatest comics characters of all time" and "movie cameo star." Watch Stan jump, roll and climb his way through L.A. with skills that would even inpress Spider-Man. »3/14/13 10:30am 3/14/13 10:30am
The folks at How It Should Have Ended are pros at cooking up better, hilarious endings to blockbuster films, and Stan Lee has a tendency to show up in every Marvel movie. So what happens when the two team up to insert Stan Lee in non-Marvel movies? Let's just say there would be fewer Star Wars films in the world—and… »2/16/13 7:30am 2/16/13 7:30am
Some people get annoyed at Stan Lee's cameos in all the Marvel movies, but not me. Because I know that when Lee is filming those appearances, he's prevented from making the irrelevant, depressing, terrible, generic superhero-based projects with which he's filled the last 20 or so years of his life. Like his latest,… »11/30/12 9:00am 11/30/12 9:00am
There are many types of superhero movies: campy, dark-and-gritty, kid-friendly, gonzo, etc. But really, there are just two kinds: movies that actually have something to say about heroism and sacrifice, and ones that don't. On that basis alone, Amazing Spider-Man is a win. »7/03/12 9:00am 7/03/12 9:00am | {
"pile_set_name": "Pile-CC"
} |
Clean Look from Rubbermaid
Clean Look is the range of air, surface and skin care systems launched by Rubbermaid. The range is said to feature the same coordinated look and contemporary styling for the modern washroom.
Clean Look comprises different products drawn from the Air Care, Surface Care, and newly launched Skin Care system ranges. Each dispenser is available in black, white or chrome finishes, and users can select the particular match or line-up of fittings that best suits their washroom.
The range is also said to promote good hygiene. For example, Clean Look Surface Care solutions systematically ensure both visible surfaces and out-of-view areas - such as drains and pipes, on and around toilets and urinals - are consistently clean, eliminating germs and tackling the source of bad odours. And with the Skin Care fittings, there is touch-free operation and antimicrobial technology incorporated. | {
"pile_set_name": "Pile-CC"
} |
LAHORE: Principle decision of restoration of Muttahida Majlis-e-Amal (MMA) has been made in a meeting of heads of the political parties. It was informed by Jamiat Ulema Islam (JUI-F) chief Maulana Fazl-ur-Rehman in a joint press conference after a six parties meeting held at Jamat-e-Islami Headquarters, Mansoora, here on Thursday. He said the MMA will...
It was informed by Jamiat Ulema Islam (JUI-F) chief Maulana Fazl-ur-Rehman in a joint press conference after a six parties meeting held at Jamat-e-Islami Headquarters, Mansoora, here on Thursday.
He said the MMA will be restored on the previous manifesto which will be finalized by the steering committee of the religious parties and its formal announcement will be made in December meeting to be held at Karachi.
He said democratic stability in the country is important and Pakistan is unable to bear any new political mishap.
Jamat-e-Islami Ameer Sirajul Haq while addressing the media said supremacy of the law and constitution is the only way and the solution of the issues of the country.
He said elections should be held on time and delay in the election will not be acceptable. He demanded the government to restore oath regarding the Khatm-e-Nabuwwat in its real form.
Siraj said Pakistan is facing social and financial crises, adding that all issues can only be resolved through the rule of law and merit.
He said other religious parties will also be contacted.
Earlier, all recommendations given by the steering committee of the six parties were accepted by the all parties in the meeting.
It was decided that the last and final meeting will be held at Karachi which will be presided over by Shah Owais Norani and final announcement of the restoration of the MMA will be made in that meeting. - APP | {
"pile_set_name": "OpenWebText2"
} |
Type of music generally:
Status:
See also:
Comparisons:
Covers/own material:
Own, occasional cover
General comments:
She's cool in a poet-with-crunchy-guitar way sort of like Ani DiFranco.
With Erin, the whole is definitely more than the sum of the parts. She's a really good musician (plays guitar and banjo, among other things), and a very clever songwriter. Not much of a voice, but it doesn't matter. Her music goes from swing to country to jazz to rock and back again, sometimes in the course of one song. She's also a very engaging performer. She's just so damned cute, you can't help but like her—but the music will be enough to get you there on its own. (meth@smoe.org)
if you have not seen her, you really really need to!! she's a brilliant musician who i think is on the brink of some serious success. amazing guitarist and ingenious songwriter. she has lately been heading in a more jazz/swing direction from her folk roots. Susan Werner calls her "post-modern swing." (Jess913@blackfoot.net)
Comments about live performance:
I have to say I was quite pleasantly surprised. Vocally she sounds a lot like Beth Orton, and her music is acoustic/electric thoughtful folk-pop. I picked up a copy of her tape, which I'm just listening to now. I'll definitely see her play again. (c. 1/99)
I'd seen her once before and she was pretty good. Her first set was songs that really don't do all that much for me, but her second set was much, much better. I think she's got a long career ahead of her, and I hope she develops into the vast potential she's showing. She really is a
good guitar player, too. (3/99)
Last night Erin McKeown played the longest, and best set I've seen her do. She played both acoustic and electric guitar, and the sound was great. She told some really amusing stories in between songs, too, including one that has forever altered the way I will hear "Blackbirds". :} It's amazing how quickly she has gone from someone I wouldn't mind missing as an opening act to someone I will drive a number of miles to see. Her command of so many different musical styles and her exceptional ability on the guitar is truly scary for someone who just turned 23. She's not to be missed if she comes to your area. (11/00)
if you get the chance to see Erin McKeown with her band, don't pass it up for ANY reason. She's great solo, but with the band...oh my god. They keep getting exponentially better every time we see them, and it's starting to get rather scary. (7/02)
What a way to begin! Erin was also accompanied by Dave Chalfant and Lorne Entress, who have been her band on those occasions when she's been able to have one. She rocks in so many different ways...and it was great to see how many people were going apeshit over her too. Thinking about how Ani DiFranco was scheduled to come onstage to end the day, I thought to myself, "Erin's the little folksinger now". She just keeps getting better and better. Her new songs are all incredible. (7/02, meth@smoe.org)
I have heard "Blackbird" before and just sort of threw it away but now I want to go back and listen to everything...she's so much fun live and has a great stage prescence that you can't help but fall in love with her and her music. Definitely worth seeing! (RocketsTail@aol.com)
I just got back from a late night at Café du Nord where I caught Erin McKeown for the first time. Erin was great. She is very dynamic, subtley playful, and short. Her promotional material: "...a guitar style somewhere between Django and G. Love." I think Django is right on the money. If you can make any of these shows, you should. At a recent live Erin McKeown show (9-Jun-2K at Rose Street in Berkeley) Erin told the audience that she tours during her breaks from college. Someone in the audience asked her what she was majoring in and she reluctantly told us, early American music. Simultaneously, everyone in the room uttered "Ohhhhhhhhhh." Obviously a primary influence in her music. (6/00, drewh@bitwise.com)
Erin lived up to some of the raves she's gotten. (12/01, mcurry@io.com)
I saw Erin McKeown last night in Santa Monica. First time seeing her full show and I enjoyed the heck out of it. Reminded me of Leslie Feist and Sarah Harmer.
Erin's got some nice guitar chops. Not flashy, but solid. However, she was running one of her guitars through various effects and a volume pedal into the soundboard and either she or the sound guy had the bass eq pumped up big time. Every time she hit the low strings, the subs in front of the stage kicked so hard that I could feel the punch throughout my body and in the
walls. The bass was so physical, I thought I was at a rock concert and it obscured whatever intricate work she was doing in the upper registers on the guitar. Her other guitar, a semi-hollow body electric, was plugged into a little amp which was mic-ed and that didn't present any low-end problems. (1/03)
I also saw Erin McKeown again this month, and came away a bit disappointed. She was only with a drummer this time, and the lack of other backing players made for a less energetic show, I thought. Her set with the full band last year was THE best concert of the year for me, and her previous solo shows had a certain intimate intensity, but this one fell well short of both experiences. Part of the problem, I think, was the audience, which didn't seem to be giving enough energy for her to feed back on. There wasn't even an encore set because the final applause petered out too quickly. Ah well. (5/04, Paul2k@aol.com)
i'm also a huge, devoted, besotted fan.
i'll admit, before the show i wasn't so sure about Sing You Sinners based on the samples. `cou cou' was a bit painful, and the rest didn't do a lot for me—i'm not usually fond of cover albums. i absolutely adore her other three major releases, having bought `grand' at the first concert when it was new, then gone back to `distillation', and having finally bought `we will become like birds' a few months ago and immediately fallen head over heels for it as always. but after the show i immediately bought my copy of SYS as well—it is fabulous! she really makes the songs intensely her own—no real surprise there.
and her new drummer is amazing. (3/07, damon)
Availability:
Ecto priority:
Group members:
Guest artists:
Comments:
I don't think it fairly compares at all, really—it's very early and unpolished. I have a cassette copy of this and I hardly ever listened to it. It's in the "better live than in the studio" category. (meth@smoe.org)
This album is subtitled Demos and Live Material 97-99 on the back, so people should know what they're getting. It's not a bad album, just a bit rough. There are some good songs, and Erin's unique sensibility is already quite developed. It's an interesting look at the early stages of a unique artist. (JoAnn Whetsell)
Produced by:
Dave Chalfant
Comments:
Years from now, when connoisseurs of fine, non-genre-specific music steeped in the various traditions of Americana look back on where it all began for Erin McKeown, they will put on this album and smile. This young woman has a stellar career ahead of her. From the whimsical "Queen of Quiet" into the driving, funky-bass-laden "Blackbirds" and on, Erin leads us through cowboy tunes to brooding singer/songwriter goodness, with stops at swing and jazz along the way. Dave Chalfant's production perfectly enhances the songs, so a listen through headphones is always a rewarding experience. I have no idea where I would file this album in a record store sorted by genre. I guess I'd just be forced to label a new bin "Brilliant" and display it prominently there. (meth@smoe.org)
it is an amazing collection of songs, a true work of art. unlike any cd you have yet heard. and of course produced by mr. dave chalfant, and with harmonies by such lovely and talented people as ms. katryna nields and ms. beth amsel. (Jess913@blackfoot.net)
If anyone hasn't been lucky enough to pick up a copy of her new album, Distillation at one of her recent shows, make a point of getting it. Outstanding stuff, and she isn't to be missed live. (cmont@rci.rutgers.edu)
Produced by:
Dave Chalfant
Comments:
I've been eagerly anticipating this one for a long time, made longer by the fact that just when Erin was finishing up recording, some new songs came to her that she just had to put on the CD, so that pushed everything back a couple months. Wouldn't you know it, two of those latecomers are the best tracks on the disc: the album-opening "Slung-Lo" and the best single song released so far this year, "Cosmopolitans."
Once again, Dave Chalfant (formerly of The Nields) is the producer, and he knows just what to do to make Erin's music shine. Like Distillation, there is a variety of styles represented on the album, from Tin Pan Alley-like ditties to power pop to all-out rockers. And of course there's a Judy Garland cover ("Lucky Day"). Judy shows up all over the album, as a matter of fact: she's mentioned by name in "Cinematic", and while she's not named in the dark, groovy "Cosmopolitans" I knew instantly that the song is about her ("advice, agents, and taped late night whiskey/tiny cups for a tiny lady/opera heels are swiftly growing indecent/and a lady in descent/falling forward towards the cosmopolitans and ladies/looking for pills in draperies").
It was clear from the first listen that this disc is going to be in my top 3 for the year, easily. It kicks every imaginable kind of ass, and was every bit worth the wait. (meth@smoe.org)
I know she has her fans here, she's one of the people I've been meaning to check out for some time, now. But...well, it's pleasant enough, I guess, but there's nothing here that really grabs me. I've listened to it several times hoping that something will leap out at me but, apart from the Go-Go-esque "Cinematic," I can't think of it as anything other than...pleasant. (adamk@zoom.co.uk)
Erin has such a unique sensibility and such varied influences, and they're all on display here on Grand. While not all of it is for everyone, there's probably something here for everyone. From the power pop to straight folk to old-fashioned blues and swing. While not all of it works for me, what does I enjoy a lot. (JoAnn Whetsell)
Release info:
Availability:
Wide
Ecto priority:
Highly recommended
Group members:
Erin McKeown—vocals, all guitars, bass on "Air", synthesizer on "We Are More", Wurlitzer on "The Golden Dream"
Guest artists:
Matt Chamberlain—drums
Sebastian Steinberg—bass
Steve Moore—piano, Wurlitzer, beautiful little sounds
David Berger—drums on "You Were Right About Everything" and "Bells and Bombs"
Juana Molina—vocals on "The Golden Dream", inimitable electronic self on "Air" and "We Are More"Peter Mulvey—vocals on "Delicate December"
Tucker Martine—drums on "Life on the Moon", all tambourines
Produced by:
Tucker Martine and Erin McKeown
Comments:
I am officially obsessed with We Will Become Like Birds. I think it has already achieved Desert Island Disc status. (meth@smoe.org)
This is far and away my favorite of Erin's albums. It has all the things I like about her music and, to put it bluntly, none of the things that annoy me. (JoAnn Whetsell)
Produced by:
Erin McKeown
Comments:
wonderful live recording of an incredible show at Joe's Pub in NYC,
which woj and I attended...does a great job capturing the experience of seeing one of the best live performers of our generation in concert (meth@smoe.org)
Love it, love it, love it. This live recording captures Erin's spirit, energy, and personality. Her studio recordings are sampled equally but so differently with the band treatments. There are also 2 new songs. Essential listening for fans. (JoAnn Whetsell)
Produced by:
Erin McKeown
Comments:
This has really grown on me. I think at first I found the songs too stylistically varied to hang together as an album. But it doesn't feel that way to me now, even though there is a lot of variety, from Monday Morning Cold-type spoken word to New Orleans jazz.
Although often billed as a political album, there are also songs about love and family. But it is Erin's most political album to date, with a number of songs ("The Politican," "The Jailer," and "Baghdad to the Bayou" most obviously) consciously addressing social and environmental justice issues. I pre-ordered and got the bonus acoustic version of the album, which I also really like, so that's worth checking out if you can find it. (JoAnn Whetsell)
DISCLAIMER: Comments and reviews in the Ectophiles' Guide are excerpted from the ecto mailing list or volunteered by members of the list. They are the opinions of music enthusiasts, not professional music critics.
Entry last updated 2017-11-28 00:18:00.
Please request permission if you wish to
reproduce any of the comments in the
Ectophiles' Guide in any context. | {
"pile_set_name": "Pile-CC"
} |
I Use GitHub.app and You Should Too - bbaumgar
http://bbaumgar.svbtle.com/githubapp
======
bradleyland
I too find Git to be the kind of tool that works well through a GUI. However,
I went one step further and bought Tower [1]. In addition to the many things
that GitHub.app does, Tower takes things one step further. If you tried using
GitHub.app, but ran up against a Git activity that isn't exposed through the
app, then you should take a serious look at Tower.
One specific example is partial commits within a single file. Tower shows a
diff view of edited files that breaks edits from different regions of a single
file in to chunks. You can stage/un-stage these chunks right through the GUI.
This is very similar to `git add -p filename.ext`, but with a very nice GUI.
1: [http://www.git-tower.com](http://www.git-tower.com)
------
tiquorsj
It still has major issues. But, for many things it is absolutely better to
have a GUI.
------
mcmillion
I use SourceTree for most of these same reasons.
| {
"pile_set_name": "HackerNews"
} |
*To the Editor:*
To date, coronavirus severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has infected 2.2 million people and has killed more than 150,000.[@bib1] The population groups most susceptible to severe and fatal coronavirus disease-2019 (COVID-19) are older adults and those with chronic underlying chronic medical disorders. The residents of long-term care facilities (LTCFs) typically combine those 2 features and are, thus, particularly at risk. In France, 9.4% of the population is over age 75 years and nearly 600,000 people currently reside in LTCFs for older dependent individuals. To date, more than 60% of the French LTCFs have reported at least 1 case of COVID-19 among their residents.
Estimated overall mortality among patients with COVID-19 is 10% in France but reaches up to 30% in LTCFs. There are, however, substantial differences in mortality rates between the different LTCFs. [@bib2] What explains these differences?
We intervened in 1 LTCF located in the Southern Île-de-France region that had registered more than 24 deaths related to COVID-19 among the 140 residents in 5 days. No acute respiratory distress syndrome was observed, and mortality was mainly due to hypovolemic shock. Most of the victims had been left alone in their rooms for confinement settings for many days without help because of the lack of protective masks and the work overload for caregivers affected by a 40% staff absenteeism rate. The dependent infected residents were confined and no longer received the usual assistance for drinking and eating. In addition, general practitioners stopped their physical examination visits, limiting their interventions to telemedicine, which proved unsuitable whenever feasible at all.
With appropriate resources lacking, the "disease linked to confinement" thus proved more fatal than COVID-19 itself. We did not observe this phenomenon in other LCTFs where healthcare staff and physicians were physically present in full force.
A task force team intervened as soon as the fifth death was reported. Adapted infusion to restore hydroelectrolytic balance as well as oxygen therapy per World Health Organization guidelines led to a rapid improvement of this high mortality trend.[@bib3] ^,^ [@bib4]
Disproportionate mortality because of COVID-19 in LTCFs is not a fatality. Continuous provision of pragmatic medicine and wellness care will limit the devastating impact of this infection in dependent older people.
| {
"pile_set_name": "PubMed Central"
} |
Grid Solutions
Grid Solutions, a division of GE, is a major solutions provider and thought leader in the effort to modernize and optimize how we generate, move and consume energy. They provide products and services that modernize the electrical grid. iST has been a partner of GE Digital Energy for more than 15 years. | {
"pile_set_name": "Pile-CC"
} |
Wales + Family holidays | The Guardianhttp://www.theguardian.com/travel/wales+familyholidays
Indexen-gbGuardian News and Media Limited or its affiliated companies. All rights reserved. 2015Tue, 03 Mar 2015 19:45:45 GMT2015-03-03T19:45:45Zen-gbGuardian News and Media Limited or its affiliated companies. All rights reserved. 2015The Guardianhttp://assets.guim.co.uk/images/guardian-logo-rss.c45beb1bafa34b347ac333af2e6fe23f.pnghttp://www.theguardian.com
Mountain biking in Wales … it's time to get bold and bravehttp://www.theguardian.com/travel/2015/jan/09/zoe-williams-mountain-bike-park-wales
<p>How would a pair of physical cowards get on at a dedicated mountain bike park in Wales? After a two-hour private lesson, one of them became completely fearless – and it wasn’t mum</p><p>I love rain, Wales, bikes and mini-breaks. I don’t mind long drives and I haven’t spent two nights on my own with my son, Thurston, since the night he was born, and the night after, seven years ago. He hates rain, doesn’t know much about Wales, loves hotels (“I definitely think this is the best place we’ve ever been,” he said, as we arrived at the reception of Nant Ddu Lodge and someone smiled at us), is OK on a bike, and was really pleased to have a weekend away with me until he found out that there was no Wi-Fi.</p><p>We were perfect for BikePark Wales, a £1.8m mountain bike park that opened in Merthyr Tydfil in 2013 – except that we’re pathetic physical cowards, both of us. We’re like relay-jellyfish: the minute one of us gets up the courage to do anything, the other freaks out. Which is why we’re trying out the private lessons the park now offers, to see how they cope with scaredy-cat mountain biking novices.</p> <a href="http://www.theguardian.com/travel/2015/jan/09/zoe-williams-mountain-bike-park-wales">Continue reading...</a>Cycling holidaysWalesFamily holidaysShort breaksDay tripsTravelFri, 09 Jan 2015 06:00:10 GMThttp://www.theguardian.com/travel/2015/jan/09/zoe-williams-mountain-bike-park-walesPhotograph: Andrew LloydTackling a steep run in BikePark Wales. Photograph: Andrew LloydPhotograph: Andrew LloydTackling a steep run in BikePark Wales. Photograph: Andrew LloydZoe Williams2015-01-09T06:00:10ZThe Bunkhouse, near Hay-on-Wye, Powys: accommodation reviewhttp://www.theguardian.com/travel/2014/sep/20/-sp-the-bunkhouse-near-hay-on-wye-wales-accommodation-review
<p>This poshed-up dormitory is full of stylish touches – and on the River Wye near the beautiful Black Mountains – but the scene-stealer is its indoor slide</p><p>Woodburner? Check. Rain showers? Yep, three of ’em. Tubular slide that hurtles you down to the ground floor like a fireman in two seconds flat? You bet!</p><p>A stainless steel chute – built to order in Germany – would not be on many people’s wishlist for a weekend retreat, but it’s bloody good fun, and for half our party of three kids and three adults (you can guess which half) <em>the</em> best thing about The Bunkhouse. It is the wackiest of many bespoke touches that make it such an original and enjoyable place.</p><p>The slide is the wackiest of the many bespoke touches that make this such a fun place</p> <a href="http://www.theguardian.com/travel/2014/sep/20/-sp-the-bunkhouse-near-hay-on-wye-wales-accommodation-review">Continue reading...</a>WalesSelf-cateringHotelsGroup tripsTravelShort breaksFamily holidaysFood and drinkCottagesSat, 20 Sep 2014 06:00:10 GMThttp://www.theguardian.com/travel/2014/sep/20/-sp-the-bunkhouse-near-hay-on-wye-wales-accommodation-reviewPhotograph: PRPhotograph: PRPhotograph: Michael Sinclair/PRThe lounge at the Bunkhouse – stylish, but short on privacy. Photograph: Michael SinclairPhotograph: Michael Sinclair/PRThe lounge at the Bunkhouse – stylish, but short on privacy. Photograph: Michael SinclairGavin McOwan2014-09-20T06:00:10ZThe best of the UK’s national parkshttp://www.theguardian.com/travel/2014/jul/28/the-best-of-uk-national-parks
To mark National Parks Week, we’ve rounded up the best ways to enjoy some of the country’s most celebrated landscapes, with expert’s tips, favourite campsites, activity guides – and our national parks picture quiz<p>Today is the start of <a href="http://www.nationalparks.gov.uk/visiting/national-parks-week-2014">National Parks Week</a>, which is celebrating the UK’s 15 national parks with hundreds of events, from rangers’ walks and wildlife watching to river rafting and pony rides. You can go <a href="http://lakedistrict.gov.uk/visiting/events">rafting or pony trekking in the Lake District</a>, have a <a href="http://www.northyorkmoors.org.uk/visiting/what-to-see-and-do/events/nym-events/teddy-bears-picnic2">teddy bears’ picnic in the North York Moors</a> or <a href="http://www.nationalparks.gov.uk/visiting/national-parks-week-2014/2014-national-parks-week-events/2014-national-parks-week-events/brecon-beacons-npw-events/dark-skies-evening">study the stars with an astronomer in the Brecon Beacons</a>.</p><p>Who better to show you around the parks than the people who live, work and play in them? We’ve asked <a href="http://www.theguardian.com/travel/series/uk-national-parks-rangers-guides">rangers from seven national parks to share their favourite beauty spots, places to eat, drink and stay</a> – and in our <a href="http://www.theguardian.com/travel/2009/jul/28/uk-national-parks-activity-guide">local experts’ guides</a>, kayakers, climbers, hikers and fishing enthusiasts recommend the best ways to get active in Britain’s great outdoors.</p> <a href="http://www.theguardian.com/travel/2014/jul/28/the-best-of-uk-national-parks">Continue reading...</a>United KingdomNational parksFamily holidaysDay tripsEnglandScotlandSummer holidaysWalesEnvironmentTravelEuropeMon, 28 Jul 2014 14:11:42 GMThttp://www.theguardian.com/travel/2014/jul/28/the-best-of-uk-national-parksPhotograph: /AlamyHope Valley below The Great Ridge, Peak District national park, Derbyshire. Photograph: AlamyPhotograph: /AlamyHope Valley below The Great Ridge, Peak District national park, Derbyshire. Photograph: AlamyGeorgia Brown2014-07-28T14:11:42ZMotorway breaks near the M3 and M4http://www.theguardian.com/travel/2014/jul/05/motorway-breaks-m3-m4-family-holidays
Heading to or from south Wales or the West Country this summer? We pick 10 places to refuel, stretch your legs and exercise fractious kids just off the M3 and M4<p></p> <a href="http://www.theguardian.com/travel/2014/jul/05/motorway-breaks-m3-m4-family-holidays">Continue reading...</a>Road tripsFamily holidaysSummer holidaysDay tripsEnglandWalesTravelTop 10sUnited KingdomSat, 05 Jul 2014 06:00:00 GMThttp://www.theguardian.com/travel/2014/jul/05/motorway-breaks-m3-m4-family-holidaysPRPRPRPRAlamyPhotograph: AlamyAlamyPhotograph: AlamyGetty ImagesPhotograph: Getty ImagesPRAlamyPhotograph: AlamyJohn Millar/National Trust ImagesVisitors at Aberdulais Falls, south Wales Photograph: John Millar/National Trust ImagesJohn Millar/National Trust ImagesVisitors at Aberdulais Falls, south Wales Photograph: John Millar/National Trust ImagesSarah Smith2014-07-05T06:00:00Z10 of the UK's best hidden beaches for the weekendhttp://www.theguardian.com/travel/2014/may/22/10-best-uk-hidden-beaches
Perfect little coves, cooling plunge pools and tasty seaside caffs – Daniel Start, author of Hidden Beaches, reveals some of Britain's lesser-known coastal spots for family fun<p><strong>Good for families, food and sunsets</strong><br />Just on the outskirts of Woolacombe, this sandy cove, perfect for sunsets, has an island lookout and a beach cafe that serves up Sri Lankan curry (bring your own drinks). There are low ledges from which the older children jump, and sand made from crushed shells that seems as if it was washed in from the Caribbean. Grunta Beach is just beyond, or carry on around Morte Head to wild Rockham Bay, set just below <a href="http://www.northmortefarm.co.uk" title="">North Morte Farm campsite</a>.<br />• <em>From main Woolacombe beach, head north along the Esplanade for 300m. The cove is opposite Devon Beach Court. Barricane Beach Cafe is open May–Sept, except if raining (07969 189304). Bring a rug. Three mins walk</em></p> <a href="http://www.theguardian.com/travel/2014/may/22/10-best-uk-hidden-beaches">Continue reading...</a>Beach holidaysFamily holidaysEnglandScotlandWalesTravelTop 10sThu, 22 May 2014 05:00:00 GMThttp://www.theguardian.com/travel/2014/may/22/10-best-uk-hidden-beachesdanielstart.comdanielstart.comdanielstart.comdanielstart.comdanielstart.comWendy Kirkwood/PRPhotograph: Wendy Kirkwooddanielstart.comBarricane Beach, Woolacombe, North Devon Photograph: danielstart.comDaniel Start2014-05-22T05:00:00ZHalf-term days out: family ideas for the holidayshttp://www.theguardian.com/travel/2013/oct/24/half-term-holiday-activities-family-october
With the first holiday of the school year upon us, <strong>Joanne O'Connor</strong> picks events and activities to keep the kids happy next week – and no, they're not all Halloween themed<p>The newly revamped <strong>London Dungeons</strong> is going big on Halloween, with live shows, special effects and an abundance of pumpkins until 9 November (online tickets from £19.60 adult, £14.95 under-16s , <a href="http://www.thedungeons.com/london/en/" title="">thedungeons.com</a>). But when it comes to the chill factor, an evening narrowboat trip along the <strong>Regents Canal </strong>and into the pitch-black Islington Tunnel might just have the edge, especially when you discover a "witch" on board (26-27 Oct, booking essential, adults £10, children £8, 020-7713 0836, <a href="http://www.canalmuseum.org.uk/" title="">canalmuseum.org.uk</a>). On a less-scary note, the <strong>British Library</strong> is bringing its Children's Illustrated Classics exhibition to life with Peter Pan-themed installations and a live storyteller (29-30 Oct, free, <a href="http://www.bl.uk/whatson/events/event153629.html" title="">bl.uk</a>), while the <strong>Museum of Childhood</strong> in Bethnal Green will encourage children to channel their inner super-hero with mask-making, dressing up, and the chance to test their powers at the Superhero Skills Station (28 Oct-1 Nov, free, <a href="http://www.museumofchildhood.org.uk/" title="">museumofchildhood.org.uk</a>).</p> <a href="http://www.theguardian.com/travel/2013/oct/24/half-term-holiday-activities-family-october">Continue reading...</a>Family holidaysDay tripsSchool holidaysMuseumsHalloweenEnglandWalesTravelThu, 24 Oct 2013 05:00:00 GMThttp://www.theguardian.com/travel/2013/oct/24/half-term-holiday-activities-family-octoberPRNational Wetland CentrePRBewilderwood Halloween activitiesPRHalloween at the Royal ArmouriesPRBrownsea Island inDorset, where one of last red squirrel colonies can be foundPatrick MulvaneyThe Black Country Living Museum. Photograph: Patrick MulvaneyPRHalloween at the London DungeonPRHalloween at the London DungeonJoanne O'Connor2013-10-24T05:00:00ZSearching for the perfect beach – in Pembrokeshirehttp://www.theguardian.com/travel/2013/jul/19/searching-for-the-perfect-beach-pembrokeshire
Forget the Caribbean or Thailand, Pembrokeshire has the world's best beaches, says Kevin Rushby, who sets out with his daughter and a vintage VW campervan to find the ultimate stretch of shore<p>I must go down to the seas again, to the lonely sea and the sky, and all I need is a neoprene wetsuit, an inflatable kayak, a telescopic fishing rod, a body board, a power kite, a slimline collapsible barbecue, two moon chairs, a windbreak, and several large dry bags jammed with other essential gadgets. How did I ever manage in the past? When I was 10 years old I went to Pembrokeshire and had a fabulous time on those miraculous beaches with no more than a pair of swimming trunks. Now I was taking my daughter Maddy, also 10, and we had a classic VW campervan filled with everything the outdoor sports megastore can offer. We were on the hunt for the perfect beach, and we had the modern armoury to enjoy that spot to the utmost.</p><p>Now, I don't know if you have ever considered what makes the perfect beach, but clearly it is not sand so hot it burns your feet, disease-laden tropical sandflies, shark attacks and head-splitting falling coconuts. No. Any search for sandy coastal perfection should be contained within the limits of Tenby in the south and Cardigan in the north – the Pembrokeshire coast. It's <a href="http://www.guardian.co.uk/travel/2013/jul/18/top-10-secret-secluded-beaches-wales">a stretch that has at least 243 beaches of unparalleled beauty</a>, and the kind of limpid aquamarine saltwater that has sent poets into raptures.</p> <a href="http://www.theguardian.com/travel/2013/jul/19/searching-for-the-perfect-beach-pembrokeshire">Continue reading...</a>PembrokeshireBeach holidaysRoad tripsWalesUnited KingdomTravelFamily holidaysFri, 19 Jul 2013 20:00:00 GMThttp://www.theguardian.com/travel/2013/jul/19/searching-for-the-perfect-beach-pembrokeshireKevin Rushby for the GuardianMaddy on the cliff path to Marloes beach, awarded a 10 after a blissful day. Photograph: Kevin Rushby for the GuardianKevin Rushby for the GuardianMaddy on the cliff path to Marloes beach, awarded a 10 after a blissful day. Photograph: Kevin Rushby for the GuardianAlamyNewgale beach is big, fun and popular with surfers. Photograph: AlamyKevin Rushby2013-07-19T20:00:00ZBank holiday and half-term events for families around the UKhttp://www.theguardian.com/travel/2013/may/24/bank-holiday-half-term-family-events
Street art in Bristol, a Neverland theme park opening in Plymouth and raft racing in Portrush are just some of the family-friendly events taking place around the country over the bank holiday and half term<p>Head over to Hampton Court Palace over the long weekend, but don't forget your sandwiches and scotch eggs, as all ticket holders are invited to join a mass picnic in the grounds. Admittedly, the agenda doesn't sound particularly appetising – offering picnickers the chance to meet a blood-sucking leech and have a "smallpox makeover". But plenty of gruesome tales over lunch means kids will enjoy it far more than the usual riverside picnic. For those with more refined tastes, there's a Pimm's bar and cream teas, as well as a barbecue for those who forget their hampers. <br /><em>• 0844 482 7777, </em><a href="http://www.hrp.org.uk/HamptonCourtPalace/WhatsOn/Thebigpicnic" title=""><em>hrp.org.uk</em></a><em>, adults £16.50, children free</em></p> <a href="http://www.theguardian.com/travel/2013/may/24/bank-holiday-half-term-family-events">Continue reading...</a>Family holidaysFamilyTravelUnited KingdomEuropeEnglandWalesNorthern IrelandScotlandLondonLeedsSchool holidaysCornwallBristolFri, 24 May 2013 13:46:00 GMThttp://www.theguardian.com/travel/2013/may/24/bank-holiday-half-term-family-eventsDavid Lindsay/PRLeeds Loves Food festival. Photograph: David LindsayAlamyAn artist at work at last year's Upfest, Bristol's urban art festival. Photograph: AlamyC&J Willis PhotographyArundel Castle will be under siege this bank holiday. Photograph: C&J Willis PhotographyPRRomans at Hadrian's WallRNLIPortrush raft race, Northern Ireland Photograph: RNLINick Wilkinson/NTILast year's picnic at Hampton Court Palace had a Jubilee theme. Photograph: Nick Wilkinson/NTIVicky Baker2013-05-24T13:46:00ZLate Easter breaks in the UKhttp://www.theguardian.com/travel/2013/mar/13/late-easter-spring-breaks-uk
From feeding lambs on a Welsh farm, to Horrible Histories at Warwick castle or guided glamping gypsy-style, there are plenty of late Easter trips for those who prefer to stay closer to home<p>Among the hills and rivers of the Upper Wye Valley, just north of Rhayader, sits Nannerth Fawr Farm, a 200-acre working farm that ticks every box as far as family spring breaks are concerned. There are river and woodland walks, purpose-built cycle routes (borrow bikes by arrangement or bring your own), an outdoor play area with castle and playhouse, games room with pool and table tennis, falconry sessions (book in advance), a hide above a badger sett and lambing, which is timed to coincide with the Easter holidays so children can help with feeding. And that's just the farm itself. The farm's two self-catering cottages are fully booked over Easter but there is still availabilty in the Loft, a top-floor apartment which sleeps two but a cot bed can be booked, so would be perfect for a couple with a toddler. Plus the gypsy caravan and showman's trailer. Or, if you're feeling brave, there's the campsite. Real fires are allowed on site and you can hire camping equipment if you don't have your own. <br />•<em> The Loft costs £251 for a week at Easter, camping costs £5pp per night (£6pp if you want a hot shower and loo). The caravan and trailer cost from £202 for a two-night stay. </em><a href="http://www.nannerth.co.uk/nf/" title=""><em>nannerth.co.uk</em></a><em>, 01597 811121 </em></p> <a href="http://www.theguardian.com/travel/2013/mar/13/late-easter-spring-breaks-uk">Continue reading...</a>Family holidaysEnglandTravelTop 10sCampingWalking holidaysBed and breakfastsHotelsUnited KingdomScotlandWalesLate offersWed, 13 Mar 2013 14:07:21 GMThttp://www.theguardian.com/travel/2013/mar/13/late-easter-spring-breaks-ukPRPRJohn Bradshaw/AlamyGoring Lock on the Thames. Photograph: John Bradshaw/AlamyPRPRPRThe pass of the cattle road near Cruinn Leum Round HousePRPRPRPREaster breaks ... spring lambing at Nannerth Fawr Farm in WalesPRLambing at Easter at Nannerth Farm, WalesIsabel Choat and Georgia Brown2013-03-13T14:07:21ZFamily Halloween and half-term eventshttp://www.theguardian.com/travel/2012/oct/24/halloween-half-term-family-events-uk
Haunted castles, eerie woodland walks, hair-raising ghost rides and spooky activities for all the family in our round-up of Halloween events around the UK<p>Kids will be able to roam through the grounds of Puzzlewood, hunt for bats and discover Halloween sculptures in the trees between until 31 October. This ancient woodland in the Forest of Dean is a perfect setting for an eerie game of hide and seek – the trees drip with moss and lichen and twist above spooky caves and strange rock formations. If the weather's bad there are two indoor mazes and a new push-and-pedal bike racing track for under 5s. <br />• <a href="http://www.puzzlewood.net" title=""><em>puzzlewood.net</em></a><em>, 01594 833187; adults £6.00, children £4.50, family £20, open 10am-4.30pm (last entry 3.30pm)</em></p> <a href="http://www.theguardian.com/travel/2012/oct/24/halloween-half-term-family-events-uk">Continue reading...</a>Family holidaysTravelFamilyHalloweenLife and styleDay tripsUnited KingdomEuropeScotlandWalesSchool holidaysWed, 24 Oct 2012 12:56:44 GMThttp://www.theguardian.com/travel/2012/oct/24/halloween-half-term-family-events-ukDave Willis/AlamyA past Halloween light show at Muncaster Castle. Photograph: Dave Willis/AlamyJohn Wheeler/AlamyKentwell Hall, Suffolk becomes the setting for Scaresville. Photograph: John Wheeler/AlamyPRBugs galore at the Insect Circus, Jacksons LaneMic Walker/AlamyCastle Fraser, Aberdeenshire. Photograph: Mic Walker/AlamyPhotolibrary Wales/AlamyChepstow Castle in Wales. Photograph: Photolibrary Wales/AlamyAllan Bell/AlamyBodelwyddan Castle, Wales Photograph: Allan Bell/AlamyPauline Moon/AlamyHunt for bats in the magical setting of Puzzlewood in the Forest of Dean. Photograph: Pauline Moon/AlamyPauline Moon/AlamyPuzzlewood in the Forest of Dean, Gloucestershire Photograph: Pauline Moon/AlamyGwen Pew2012-10-24T12:56:44ZOld-fashioned fun: 10 traditional UK seaside breakshttp://www.theguardian.com/travel/2012/aug/03/seaside-uk-beaches-resorts
Not all British seaside resorts have to go the way of Brighton and Whitstable … here are 10 of the most gloriously traditional, with all the fun of the fair<p>As the sailing venue for the Olympics, <a href="http://www.guardian.co.uk/travel/2012/jun/08/weymouth-dorset-sailing-olympics?INTCMP=SRCH" title="">Weymouth has made a sterling effort to move upmarket</a>: boat-shaped cafes on the beach, uplighters on the seafront, upgraded deckchairs. But underneath the gloss, it's the same old Weymouth, thank goodness. For a panoramic view, take an airlift up the shiny new Sea Life Tower – which opened in June (The Quay, 0871 423 2110, <a href="http://www.weymouth-tower.com/" title="">weymouth-tower.com</a>, from £6.50) – and look across a curve of Regency terraces to the Purbeck Hills, across the harbour to the gardens of Nothe Fort (01305 766626, <a href="http://www.nothefort.org.uk/" title="">nothefort.org.uk</a>) to the Isle of Portland. On the beach, there are donkey rides, Professor Mark Poulton's classic Punch and Judy show (<a href="http://www.weymouthpunch.co.uk" title="">weymouthpunch.co.uk</a>) and, according to the town's Sand World (Preston Beach Road, 07411 387529, <a href="http://www.sandworld.co.uk/" title="">sandworld.co.uk</a>, adult £6.50, child £4.50) the perfect sand for castles and sculptures. At Rossi's retro parlour on the seafront, the ice-cream has been made on the premises since 1937 (01305 785557). The Stables Pizza and Cider House (Custom House Quay, <a href="http://thestabledorset.co.uk/" title="">thestabledorset.co.uk)</a> is one of the new breed of restaurants that have popped up in the light of the Olympics. Cafe Oasis (01305 833054, <a href="http://www.cafeoasis.co.uk/" title="">cafeoasis.co.uk</a>), on the beach at Bowleaze Cove, is a old favourite.</p> <a href="http://www.theguardian.com/travel/2012/aug/03/seaside-uk-beaches-resorts">Continue reading...</a>United KingdomBeach holidaysShort breaksFamily holidaysDay tripsTravelDorsetEuropeWalesSussexYorkshireLancashireIsle of WightHotelsRestaurantsFri, 03 Aug 2012 21:44:00 GMThttp://www.theguardian.com/travel/2012/aug/03/seaside-uk-beaches-resortsPatrick Ingrand/Getty ImagesBeachy Head, East Sussex. Photograph: Patrick Ingrand/Getty ImagesVisitBritain/Daniel Bosworth/Getty ImagesRossi's, Southend-on-Sea. Photograph: VisitBritain/Daniel Bosworth/Getty ImagesRichard Watson/Getty ImagesThe Land Train, Bridlington. Photograph: Richard Watson/Getty ImagesTony C French/Getty ImagesJabba the Hut artwork, Mablethorpe. Photograph: Tony C French/Getty ImagesAlamyThe Great Orme Tramway, Llandudno. Photograph: AlamyAlamyPunch and Judy on the beach at Weymouth, Dorset. Photograph: AlamyAlamyPunch and Judy on the beach at Weymouth, Dorset. Photograph: AlamyLesley Gillilan2012-08-03T21:44:00ZPembrokeshire holiday guide: hotels, walks, days out, cheap eats and morehttp://www.theguardian.com/travel/interactive/2012/jul/11/holiday-guide-to-pembrokeshire-interactive
Gorgeous sandy beaches, back-to-nature family attractions, characterful pubs steeped in history, and world-class wildlife viewing – Pembrokeshire has all the ingredients for a brilliant holiday. Browse our expert tips to plan the perfect trip. If you're on a mobile device, the guide will open in a new window, customised to fit your screen. Click below to start exploring <a href="http://www.theguardian.com/travel/interactive/2012/jul/11/holiday-guide-to-pembrokeshire-interactive">Continue reading...</a>TravelWalesPembrokeshirePubsHotelsFamily holidaysBudget travelRestaurantsWalking holidaysWed, 11 Jul 2012 11:23:00 GMThttp://www.theguardian.com/travel/interactive/2012/jul/11/holiday-guide-to-pembrokeshire-interactive/Andy DaviesPuffin with sandeels in bill, Fratercula arctica, The Wick, Skomer Island, Pembrokeshire, Wales, UK, Europe Photograph: /Andy DaviesIsabel Choat, Gavin McOwan, Georgia Brown and Guardian Interactive team2012-07-11T11:23:00ZTop 10 family days out in Pembrokeshirehttp://www.theguardian.com/travel/2012/jul/11/top-10-family-days-out-pembrokeshire
Meet a Madagascan fossa, watch sheepdogs herding geese, ride a 'rollercoaster' mountain bike trail or head for a spectacular beach … Pembrokeshire has some great family days out<br /><br /><strong><a href="http://www.guardian.co.uk/travel/interactive/2012/jul/11/holiday-guide-to-pembrokeshire-interactive">• As featured in our Pembrokeshire holiday guide</a></strong><br /><strong>• What's your favourite Pembrokeshire day out? Add your tip to the comments below</strong><p>Pembrokeshire is renowned for its beaches, 26 of which have Blue Flag or Green Coast awards for their water quality and clean environments. Surfers, rockpoolers and dog walkers all have their favourites, but if you crave soft sand, sheltered swimming and the blissful absence of cafes and car parks, Barafundle bay is worth a special journey. This golden horseshoe backed by gorse-flecked dunes and woodland is accessible only via steep steps in the limestone cliffs on either side. It feels idyllically remote, but the National Trust car park and tea room at Stackpole Quay are just a 10-minute walk away – perfectly manageable with a bucket, spade and swimming cozzie in hand. For information on amenities and access at all Pembrokeshire beaches see <a href="http://www.pembrokeshirecoast.org.uk/default.asp?PID=4" title="">pembrokeshirecoast.org.uk</a>. <br /> • <em>Stackpole Quay, </em><a href="http://www.nationaltrust.org.uk/stackpole/" title=""><em>nationaltrust.org.uk</em></a></p> <a href="http://www.theguardian.com/travel/2012/jul/11/top-10-family-days-out-pembrokeshire">Continue reading...</a>PembrokeshireFamily holidaysWalesTravelBeach holidaysShort breaksUnited KingdomTop 10sAdventure travelDay tripsWed, 11 Jul 2012 09:30:00 GMThttp://www.theguardian.com/travel/2012/jul/11/top-10-family-days-out-pembrokeshireAlamyPhotograph: AlamyPRPRAlamyPhotograph: AlamyDimitris Legakis/D Legakis Photography/AthenaPhotograph: Dimitris Legakis/AthenaAlamyPhotograph: AlamyPRThe Photolibrary Wales/AlamyPhotograph: The Photolibrary Wales/AlamyKevin Rushby/GuardianPhotograph: Kevin Rushby for the GuardianCW Images / Alamy/AlamyBarafundle bay feels idyllically remote. Photograph: CW Images/AlamyCW Images / Alamy/AlamyBarafundle Bay Pembroke Photograph: CW Images / Alamy/AlamyRachael Oakden2012-07-11T09:30:00ZUK cottages: Wales and Scotlandhttp://www.theguardian.com/travel/2012/jan/19/uk-cottages-scotland-wales-self-catering
Self-catering in Wales and Scotland is all about spectacular settings amid dramatic landscapes. In the third part of our guide, we round up companies offering cottages in the two regions<br /><br /><a href="http://www.guardian.co.uk/travel/2012/jan/17/uk-cottages-rental-properties-companies-guide?intcmp=239">UK cottages: a guide to leading rental companies</a><p></p> <a href="http://www.theguardian.com/travel/2012/jan/19/uk-cottages-scotland-wales-self-catering">Continue reading...</a>CottagesSelf-cateringTravelFamily holidaysScotlandWalesShort breaksUnited KingdomThu, 19 Jan 2012 16:39:00 GMThttp://www.theguardian.com/travel/2012/jan/19/uk-cottages-scotland-wales-self-cateringprSwallow Cottage, near Fort WilliamprDalcross Castle, near InvernessprTy Glan Afon, DolgellauPRPen-yr-Heol, Brecon BeaconsPrCider House, a Sheepskin cottage, near AbergavennyPrCider House, near AbergavennyCatherine Nelson2012-01-19T16:39:00ZFree bank holiday days outhttp://www.theguardian.com/travel/2011/aug/25/family-free-days-out-bank-holiday
You don't have to spend a fortune on bank holiday family fun – there's lots you can do for free, from cycle trails in the Forest of Dean to an alternative village fete at the National Theatre<p>The National Theatre is bringing a country fair with an urban twist to London's South Bank this weekend. Artists and theatrical performers will reinterpret the traditional British village fete, with contemporary barn dancing, craftmaking, alternative folk music and story-telling sessions. And of course, no village fete would be complete without tea and cake stalls. <br />• <em>1pm-5.30pm Sunday 28 August and 1pm-4pm Monday 29 August, National Theatre Square, </em><a href="http://www.facebook.com/watchthispace" title="Watch This Space"><em>facebook.com/watchthispace</em></a><em>, </em><a href="http://homeliveart.com/current-projects/145--alternative-village-fete" title="Alternative Village Fete"><em>homeliveart.com</em></a></p> <a href="http://www.theguardian.com/travel/2011/aug/25/family-free-days-out-bank-holiday">Continue reading...</a>Summer holidaysFamily holidaysDay tripsTravelDevonCornwallLondonWalesGlasgowEssexYorkshireThu, 25 Aug 2011 12:22:00 GMThttp://www.theguardian.com/travel/2011/aug/25/family-free-days-out-bank-holidayAlamyPhotograph: AlamyMurdo Macleod/Murdo MacleodPhotograph: Murdo MacleodDavid Kjaer/RSPB ImagesPhotograph: David Kjaer/RSPB ImagesPRTwist of fete … enjoy craftmaking and story-telling sessions at the Alternative Village Fete, LondonAlamyChildren on day out. Photograph: AlamyJoanne O'Connor2011-08-25T12:22:00ZFamily days out in Augusthttp://www.theguardian.com/travel/2011/aug/19/summer-days-out-family
There's plenty of family fun to be had at the tail end of the summer holidays, from a traditional steam fair to a graffiti workshop for your budding Banksy<p>If the prospect of roller coasters or new-fangled activities (canyoning, anyone?) leaves you cold, introduce the family to some more traditional fun. Among the events on offer at the 161-year-old Grasmere games are wrestling, sheep dog displays and a family tug of war. Proper, wholesome fun! There's also a beer tent, so dads can drink a manly pint of ale while watching the terrier dog show.<br /><em>• Adult £8.50, child 5-14 £2.50. The Showfield, Stock Lane, Grasmere, </em><a href="http://grasmeresportsandshow.co.u" title=""><em>grasmeresportsandshow.co.uk</em></a><em>, 26 August, 10am-5pm</em></p> <a href="http://www.theguardian.com/travel/2011/aug/19/summer-days-out-family">Continue reading...</a>Family holidaysDay tripsTravelIsle of WightKentLondonWalesManchesterAdventure travelShort breaksUnited KingdomFri, 19 Aug 2011 15:54:00 GMThttp://www.theguardian.com/travel/2011/aug/19/summer-days-out-familyPRPRAlamyPhotograph: AlamyPRAlamyPhotograph: AlamyAlamyWholesome fun … Grasmere Sports day in Cumbria. Photograph: AlamyAlamyGrasmere Sports. Photograph: AlamyIsabel Choat and Charley McKenzie2011-08-19T15:54:00Z10 days out for kids this summerhttp://www.theguardian.com/travel/2011/aug/12/days-out-kids-summer-school-holidays
Pirates and Vikings, mini beasts and gothic horrors – plus the chance to paint a horse (yes, really). Here is our latest pick of exciting kids' activities for the summer holidays<p>If you are looking to tire out the little ones, look no further than a fun-packed day at Willows Farm Village. Back by popular demand is the farm's A-maize-ing Maze, open all day for the whole family to get lost in. New activities this summer include the JCB Young Drivers Zone for Bob the Builder wannabes, with mini-JCB diggers and tractors available for children to ride around a miniature track. There are also nine different shows daily and sports day races as well as unlimited access to bouncy haystacks, funfair rides, and an agility play trail.<br /><em>• Adult £12.50, child £13.50, under-twos free. Coursers Road, London Colney, 0870 129 9718, </em><a href="http://www.willowsfarmvillage.com/" title=""></a><a href="http://www.willowsfarmvillage.com/" title=""><em>willowsfarmvillage.com</em></a><em>. Until 4 September</em></p> <a href="http://www.theguardian.com/travel/2011/aug/12/days-out-kids-summer-school-holidays">Continue reading...</a>Family holidaysDay tripsUnited KingdomBournemouthKentWildlife holidaysAdventure travelWalesCampingTravelSummer holidaysTop 10sFri, 12 Aug 2011 12:50:43 GMThttp://www.theguardian.com/travel/2011/aug/12/days-out-kids-summer-school-holidaysPRPRPRPRPRLose yourself in Willows Farm maize mazeHalima Ali and Kamilla Baiden2011-08-12T12:50:43Z10 days out for kids this summerhttp://www.theguardian.com/travel/2011/aug/05/days-out-kids-summer-school-holidays
Here's our latest roundup of (mostly free) ways of keeping the kids happy over the school holidays, from pottery classes in the Potteries to playing Sherlock in Shropshire<p>Read the book? Seen the movie? Time now to take the kids to the live show of Fantastic Mr Fox. Following their successful production of James and the Giant Peach last year, the open-air touring group Illyria Theatre Company is staging a creative, interactive stage version of the Roald Dahl classic at various outdoor locations around the country, from gardens to castles to farms, throughout August. Will Mr Fox outwit the cruel farmers? <br />• <em>Prices vary according to location. For a full listing and booking information visit </em><a href="http://www.illyria.uk.com" title=""><em>illyria.uk.com</em></a></p> <a href="http://www.theguardian.com/travel/2011/aug/05/days-out-kids-summer-school-holidays">Continue reading...</a>TravelFamily holidaysDay tripsKentUnited KingdomWalesNorthern IrelandGlasgowNewcastleSussexFri, 05 Aug 2011 15:31:00 GMThttp://www.theguardian.com/travel/2011/aug/05/days-out-kids-summer-school-holidaysPRPRFestival of Fools, BelfastPRChild's play ... Fantastic Mr Fox is playing across the country this summerPRSherlock Holmes weekend, Blists HillKamilla Baiden and Jen McPherson2011-08-05T15:31:00Z10 days out for kids this summerhttp://www.theguardian.com/travel/2011/jul/27/familyholidays-day-trips
The school holidays are well under way, and if the kids are driving you mad, check out our latest events and activities for children, from enchanted princesses to electric guitars<p>From 2 August, the normally hushed rooms of Manchester Art Gallery will be disrupted by the squeals of children as they discover a fantasy world of princesses and knights. Set over the two top floors of the gallery, the transformed space will include three tents where kids under 12 can create costumes and make films of their stories to project on to the gallery walls. Artists will also be on hand to organise art activities, and there will be sensory play areas for babies and toddlers. <br /><em>• </em><a href="http://www.manchestergalleries.org" title=""><em>manchestergalleries.org</em></a><em>. Free, 2-28 August, Tuesdays to Sundays, 1-3pm</em></p> <a href="http://www.theguardian.com/travel/2011/jul/27/familyholidays-day-trips">Continue reading...</a>Family holidaysDay tripsUnited KingdomLearning holidaysCycling holidaysCultural tripsScotlandManchesterWalesBrightonBristolTravelSummer holidaysWed, 27 Jul 2011 13:39:00 GMThttp://www.theguardian.com/travel/2011/jul/27/familyholidays-day-tripsPRPRPRPRFar, far away at Manchester Art GalleryPRFar, far away at Manchester Art GalleryNalini Sivathasan2011-07-27T13:39:00ZWales on wheelshttp://www.theguardian.com/travel/2011/jun/19/wales-uk-cycling
A four-day ride from Cardigan to Hay-on-Wye gives Robert Penn the chance to savour some of Britain's most beautiful scenery – and convert his son to cycling<p> On top of the Cambrian Mountains, the world stood still. There was no sound or sign of life. The wind had dropped. Ahead, flat treeless moorland covered in tussocks of ochre and umber grasses stretched to the horizon. The singletrack road snaked round the hill and disappeared into blue sky. Behind, the Ystwyth Valley fell away, cutting its serpentine path through serried ranks of hills to the west coast, 20 miles away. I looked round slowly, until I felt sure the view was etched on to my memory. This is Wales, I thought: a perfectly formed realm with the power of a spell.</p> <a href="http://www.theguardian.com/travel/2011/jun/19/wales-uk-cycling">Continue reading...</a>WalesUnited KingdomEuropeTravelCycling holidaysFamily holidaysSat, 18 Jun 2011 23:05:00 GMThttp://www.theguardian.com/travel/2011/jun/19/wales-uk-cyclingRobert PennBorder country … a view across the Wye Valley, between Rhayader and Builth WellsPRDan and Sarah outside Conti's, LampeterRobert Penn"This is massive. Cycling is way better than TV and Xbox combined": near the top of the Ystwyth Valley in the Cambrian Mountains.
Photograph: Robert PennRobert Penn2011-06-18T23:05:00Z | {
"pile_set_name": "Pile-CC"
} |
1. Field of the Invention
The present invention relates to a process for regulating the exposure time of a light sensor. More particularly, the invention relates to a process for regulating the exposure time of a light sensor according to the variation of luminosity in the work environment in which the sensor is located.
2. Discussion of the Prior Art
Throughout the present description and the attached claims, with the term: “light sensor”, it is intended to indicate a light-sensitive optical element capable of converting a light signal, contained in a incident light beam, in an analogic electrical signal proportional to the light intensity of the light itself. In particular, the light sensor transforms the light image of an illuminated object into an electronic image thereof, in order to allow the carrying out of further operations of image processing, such as for example those connected to the reading of an optical code located on the object.
In the following, reference to light sensors of known type will be made, for example CCD or CMOS sensors, both linear and of matrix type.
As is known, a drawback associated with light sensors at present available on the market is correlated to the fact that their operation is strongly influenced by the variations in luminosity of the surface on which the image to be acquired is to be found (such surface can be more or less clear and more or less illuminated). In particular, the resolution of the image acquired by the sensor (that is the richness of details detected in the image acquired by it) considerably varies according to the variation of the luminosity of the surrounding environment and of the surface to be acquired: highly illuminated environments can as such create conditions of strong overexposure or saturation (little contrast) of the image on the sensor, whilst badly illuminated environments can create conditions of strong under-exposure (excessive dark) in the image on the sensor. In both cases, the image acquired by the sensor appears badly exposed and not very clear, therefore making it impossible to detect details having small sizes.
In particular, with reference to the reading of an optical code, the acquisition on the sensor of an image of an optical code having a low resolution is often undesired because it renders the subsequent operations of localization, reading and decoding of the code itself very approximate and rough; this is absolutely unacceptable where it is necessary to carry out a correct decoding of the code in order to unequivocally identify the object having the code thereon.
The drawbacks associated with the acquisition of an image having low resolution can be overcome by suitably regulating the exposure time of the sensor according to the variations of luminosity of the surrounding work environment and of the surface to be acquired. In particular, where an increase in luminosity occurs in the work environment, it would be advisable to set a shorter exposure time on the sensor, in order to avoid the risk of generating conditions of saturation of the acquired image; viceversa, in the case where a decrease in luminosity occurs in the work environment, it would be advisable to set a higher exposure time on the sensor, in order to avoid the risk of generating conditions of under-exposure of the acquired image.
The majority of light sensors at present available on the market allow to set an exposure time by choosing it between a range of values, more or less extensive, each differing the one from the other by descrete amounts; such values are stated by the manufacturers of the sensors. | {
"pile_set_name": "USPTO Backgrounds"
} |
Plagiarism: using a collaborative approach in an online allied health professions course.
The purpose of the study was to evaluate the effectiveness of interventions to increase the awareness and understanding of plagiarism among undergraduate students enrolled in an online allied health professions course in a community college in the Midwestern United States. The results suggested that the interventions were effective in educating students about how to avoid plagiarism. | {
"pile_set_name": "PubMed Abstracts"
} |
The invention relates to a distilling and desalination apparatus comprising an evaporation chamber and a condensing chamber. | {
"pile_set_name": "USPTO Backgrounds"
} |
Q:
Is it possible to change a view from a user view to a node view?
I have a view that has a couple of displays and a lot of complex field definitions. I now realize the view may have been created by cloning the wrong starter view. Something went wrong such that the view is based on user and the base_table = 'user' when it should be based on nodes. Can I change it to be based on nodes? Or is there a quick way to add my display and field definitions to a newly created node view, perhaps by exporting both and copying over bits of the code? I'm using Views 2.
A:
There is no automatic way to convert a user view to a node view or vice versa.
Although you probably could get away with manually combining the fields from the export of your user view with a plain export of a new node view, it would be faster and a lot less problematic to just open the old view and your new view side by side in two browser windows and recreate everything.
Unfortunately a lot of Drupal site building is just checking checkboxes...
| {
"pile_set_name": "StackExchange"
} |
Q:
Change admin module title joomla
When I installed the module that I developed and in the module manager screen of the backend I can see the title like this.
Module Manager: Module mod_examplemodule
So I want to change it into something like this. Module Manager: Module Example Module
I have developed few Joomla modules but so far I didn't realize how to do this.
Your help on this would really appreciated.
Thank you.
Im using Joomla 2.5.8. I have just added the screen shot. Perhaps it would be more helpful.
A:
In my modules I use:
<name>Module Title</name>
<description>MOD_MODULE_TITLE_XML_DESCRIPTION</description>
I then add an entry in the language file for the description. This normally covers my needs
| {
"pile_set_name": "StackExchange"
} |
Q:
jQuery, button message doesn't change
How do I get the text beside my button to change? Everything else works fine except for these button messages. Thanks for your help.
<!DOCTYPE html PUBLIC "><head>
<script type="text/javascript" src="js/jquery-1.4.min.js"></script>
<script type='text/javascript'>
var fontSizes = [14, 16]
$(function(){
$('#PlusMinus').click(function() {
if($(this).val() == "+") {
$('#OurText').css('fontSize', fontSizes[1] + 'pt');
$(this).val("-");
}else {
$('#OurText').css('fontSize', fontSizes[0]+ 'pt');
$(this).val("+");
}
});
});
<!--NOT WORKING-->
$("button").click(function () {
$("h6").toggle();
});
</script>
</head>
<!--NOT WORKING-->
<h6>
<input type='button' value='+' id='PlusMinus'/>
Larger Text</h6>
<h6 style="display: none">Smaller Text</h6>
<!--TEXT RESIZES-->
<p id="OurText">My Text!!!</p>
</body>
</html>
BUTTON STATE 'Message should toggle between Larger Text and Smaller text'
[+] Larger Text
[-] Smaller Text
A:
This worked for me:
<!DOCTYPE html PUBLIC "><html>
<head>
<script type="text/javascript" src="jquery-1.4.min.js"></script>
<script type="text/javascript">
var fontSizes = [14, 16]
$(function(){
$('#PlusMinus').click(function() {
if($(this).val() == "+") {
$('#OurText').css('fontSize', fontSizes[1] + 'pt');
$(this).val("-");
}else {
$('#OurText').css('fontSize', fontSizes[0]+ 'pt');
$(this).val("+");
}
$("body h6").toggle();
});
});
</script>
</head>
<input type='button' value='+' id='PlusMinus'/>
<h6>Larger Text</h6>
<h6 style="display: none">Smaller Text</h6>
<!--TEXT RESIZES-->
<p id="OurText">My Text!!!</p>
</body>
</html>
The changes I made were:
changed $("h6").toggle(); to $("body h6").toggle(); and moved it up to the $('#PlusMinus').click function
moved the button out of the "Larger Text" h6 element
added < html > tag at the top
removed "Not Working" comments ;)
| {
"pile_set_name": "StackExchange"
} |
State treasurer candidate stockpiles $1 million for fall campaign
Republican state treasurer candidate Dan Rutherford, always a prolific fundraiser, today reported raising $687,000 from January through June and has $1 million available for the fall campaign.
Among the contributions was a $200,000 loan Rutherford made, a move aides described as a cash advance on pledges of future donations. Rutherford, a veteran lawmaker from downstate Chenoa who's always been a prolific fundraiser began the year with more than $568,000 in his campaign fund, state elections records show. | {
"pile_set_name": "Pile-CC"
} |
Changes in autobiographical memory specificity following cognitive behavior therapy and pharmacotherapy for major depression.
An important cognitive marker of clinical depression is a reduced ability to be specific in recalling personal memories, a phenomenon coined 'overgeneral memory'. Overgeneral memory is considered as a stable cognitive trait that is intrinsically linked with depression and independent of mood state. Previous studies show that autobiographical memory is modifiable. This study investigated whether autobiographical memory is differentially affected by treatment type. Depressed patients were randomly assigned to receive either cognitive behavior therapy (CBT) for depression or pharmacotherapy (PHT). The proportion of categoric memories decreased and the proportion of specific memories increased following both types of treatments, adding support to the view that overgeneral memory is modifiable. CBT also had a greater impact on reducing extended overgeneral memories compared to PHT. The results from the current study are important in that they show that overgeneral memory can be targeted and modified through brief treatment. The clinical significance of the finding that there was a greater decrease in extended memories in the CBT group is unclear. | {
"pile_set_name": "PubMed Abstracts"
} |
Mitosis-specific monoclonal antibodies block cleavage in amphibian embryos.
By microinjecting monoclonal antibodies that bind specifically to mitotic and meiotic cells of a variety of species, we studied the biological activity of antigens recognized by these antibodies. The antibodies recognize a family of phosphoprotein antigens that are found throughout the cytoplasm of mitotic cells and particularly at microtubule organizing centers, including centrosomes and kinetochores. Their binding is dependent on phosphorylation of the polypeptides. Immunoglobulins were introduced into Xenopus laevis and Rana pipiens oocytes or cleaving embryos using glass micropipettes. The ability of the antibody-injected oocytes to undergo mitosis or meiosis was compared with those injected with control mouse immunoglobulins. The antibodies failed to block chromosome condensation and germinal vesicle breakdown in progesterone-treated oocytes. However, functional mitotic spindles were not assembled in cleavage stage frog embryos injected with antibodies. In vitro, the binding of the antibodies to the antigens inhibited the dephosphorylation of the antigens by alkaline phosphatase. The antibody binding to the activated microtubule organizing centers (MTOC) seems to block not only the nucleation of microtubules and the organization of the mitotic spindle, but also the dephosphorylation of proteins associated with the MTOC that normally occurs at the mitosis-G1 transition. | {
"pile_set_name": "PubMed Abstracts"
} |
North Carolina Skating USA
Advertisements
Skating entails substantially work and practise, so one doesn't need t get discouraged from little setbacks like constant falling that may occur at first as these are just temporary huddles. As a learner or a beginner skater, bear in mind that there's a likelihood of falling a couple of occasions prior to being able to glide smoothly; don't give up, but follow every tip given by your trainer. Meanwhile, before going for North Carolina Skating as a beginner, endeavor to get ready safety gears like a helmet, a wrist guard, and elbow and knee pads for protection in case of a crash.
If an individual desires to obtain all the essential information relating to North Carolina Skating, the ideal place to check and get them is the items section of the web page Kayambo. Nevertheless, the teaching of safety strategies really should be paramount as a way of preventing and decreasing possible accidents during the process of finding out to Skate in North Carolina until the learners have mastered correct posture and modus operandi. Ice skating, roller skating, and snow skating are three major forms of skating available to whoever wishes to Skate in North Carolina, with one possessing different approaches, specifications, and gears from the other.
Discover and explore a skating venue, a place that you can have a memorable and cherished Christmas tree lighting in this season, look no further than the North Carolina Ice Rink is your answer for your skating needs and desires.
Main Cities in North Carolina
It's particularly likely that you go through this Main City when you visit North Carolina searching for Place in Greensboro. We are confident that its more than 269.666 inhabitants will take care of you. | {
"pile_set_name": "Pile-CC"
} |
Nehemiah D. Sperry
Nehemiah Day Sperry (July 10, 1827 – November 13, 1911) was a U.S. Representative from Connecticut.
Biography
Born in Woodbridge, Connecticut, Sperry attended the common schools and a private school in New Haven. He engaged in agricultural pursuits and worked in a mill. He taught school for several years, and then became a partner in a building and contracting firm.
He served as a member of the New Haven common council in 1853, and an Alderman in 1854. He served as Secretary of the State of Connecticut in 1855 and 1856.
He served as delegate to the Republican National Conventions in 1856, 1864, and 1888. He served as member and secretary of the national and executive committees. He served as chairman of the Republican State committee for a number of years.
He served as chairman of the recruiting committee of New Haven during the Civil War. He was appointed in 1861 as postmaster of New Haven, and served until removed by President Cleveland in 1886. He was again postmaster from 1890 to 1894.
Sperry was elected as a Republican to the Fifty-fourth and to the seven succeeding Congresses (March 4, 1895 – March 3, 1911). He served as chairman of the Committee on Alcohol Liquor Traffic (Fifty-sixth through Sixty-first Congresses). He was not a candidate for renomination in 1910.
Death and burial
He died in New Haven, Connecticut, on November 13, 1911. He was interred in Evergreen Cemetery.
References
External links
Category:1827 births
Category:1911 deaths
Category:Connecticut city council members
Category:Connecticut Republicans
Category:Members of the United States House of Representatives from Connecticut
Category:Secretaries of the State of Connecticut
Category:Republican Party members of the United States House of Representatives
Category:19th-century American politicians | {
"pile_set_name": "Wikipedia (en)"
} |
Preference Pane
A Preference Pane (often abbreviated as prefpane) is a special dynamically loaded plugin in macOS. Introduced in Mac OS X v10.0, the purpose of a Preference Pane is to allow the user to set preferences for a specific application or the system by means of a graphical user interface. Preference Panes are the macOS replacement for control panels in the classic Mac OS. Prior to Mac OS X v10.4, collections of Preference Panes featured a "Show All" button to show all the panes in the collection and a customizable toolbar to which frequently-used preference panes could be dragged. In Mac OS X v10.3, the currently-active pane would also be highlighted in the toolbar when it was selected. With Mac OS X v10.4, this functionality was dropped in favor of a plain Show All button and back/forward history arrows.
System Preferences is an application whose sole purpose is the loading of various preference panes, for system configuration. Any application can be written to use prefpanes.
Preference panes carry the .prefpane file extension.
External links
Apple Developer Connection – Preference Panes
Category:MacOS | {
"pile_set_name": "Wikipedia (en)"
} |
Q:
Possibly simple Routing Error: No route matches {:action
I think something is wrong with my create method.
When I create a new resume from http://localhost:3000/ or http://localhost:3000/resumes/new, I get the routing error shown below.
Routing Error
No route matches {:action=>"show", :controller=>"resumes"}
The app goes to http://localhost:3000/resumes address instead of http://localhost:3000/resumes/1. Not sure why.
Here is my code.
class SubmissionsController < ApplicationController
def create
@resume = Resume.new(params[:resume])
if @resume.save
#UserMailer.created_resume_email(@user).deliver
redirect_to :action => 'show'
format.html { redirect_to(@resume, :notice => 'Resume was successfully created.') }
format.xml { render :xml => @resume, :status => :created, :location => @resume }
else
@title = "Create a new resume"
render 'new'
end
end
def show
@resume = Resume.find(params[:id])
respond_to do |format|
format.html # show.html.erb
format.xml { render :xml => @resume }
end
end
end
Leaflet::Application.routes.draw do
resources :resumes
match '/' => 'resumes#new'
end
A:
I may be missing something, but, I believe you need to alter your redirect_to statement.
redirect_to resume_url(@resume)
or
redirect_to resume_path(@resume)
That should redirect the user to the "show" action in your controller with the required parameter for determining which resume to get and show.
http://guides.rubyonrails.org/layouts_and_rendering.html#using-redirect_to
| {
"pile_set_name": "StackExchange"
} |
從評圖到國外專家表揚,作為創作者,為什麼我們總是希望被看見?┃As an Artists or A Photographers, Why We Always Wish to Be Honor?
文/ 汪正翔 TEXT / Sean Wong
翻譯/ 陳仲麟
I remember one time we taked about ‘Portfolio Review’during a dinner with lots of artists. Some people think this kind of event totoally like plenty of professionals exchanging their opinions about artworks. I don’t think it something bad. However, if now we’re talking about “trying make our artworks to be honored”, especially wish to be honored by professionals abroad, make me feel something weird inside, even thought it intends to do good things.
Take photography for example, in the past few decades in this field, the honor of most kinds of awards or competitions, were decided by some few people who own knowledge, secrecy, and elite education. Those people would be responsible for picking something good enough and then present those work for the world, before the rise of art school. If we say the whole field like a wildland, those people are just like the searchlight, searching something good enough which make the classic works we see now.
Facing the globalization and international flow of information, how can artists make their artworks to be saw by the professionals?
In the other side of this issue, is there any possibility for us to think that we lack of making ourselves become the one who own the ‘light’? As we know, there is a lot of activity not onlt in Taiwan but also in Japan, Shanghai, Hong Kong. Most of them do invite some curator, art critic, or even art historian.
Because of the globalization and international flow of information as well as the the diversity of education and creation, now we can see more and more researcher or artists in the Institute of Contemporary Art launching some activity about art by themselves. However, the question we would like to ask about is that, most of the time, we couldn’t find the clear main reason why the host invite them.
For example, I remember one time I went to an art event with my artists friends, and we accidentally find out even the invitee also feel confuse about why he got invitation to this kind of lecture to be the speaker. Thanks to the globalization and international flow of information, it’s easy for people to find some information by internet. In the way, it won’t be so hard for us to find out where any people from or even judge is he or she belong to the main system or not.
We all know that any institute of Contemporary Art from every country including Taiwan do have the power to luach different kind of way to present the idea they figure out. Yet, in other foreign countries, they got more system to form and even organize some comment, for example, independent reviewer, independent curator. Most of all, thse comment won’t be one-way opinon only, it might be multi-direction or even no-limit instead of just “It’s good.”only.
Now in Taiwan, this is not the first time for us to learn that there are so many dissatisfied artists. To some artists, the choice for them to walk in the illumination or not, just like facing the Eye of Soren. As a artists, we should nerver forget to think about how to be the people who DEFINE what is ‘light’ instead of how to be AT the range of the illumination.
One thought on “從評圖到國外專家表揚,作為創作者,為什麼我們總是希望被看見?┃As an Artists or A Photographers, Why We Always Wish to Be Honor?”
好文,但是Taiwan被拼錯兩次….
“As we know, there is a lot of activity not onlt in Taiwna but also in Japan, Shanghai, Hong Kong.”以及
“Now in Taiwna, this is not the first time for us to learn that there are so many dissatisfied artists.” | {
"pile_set_name": "Pile-CC"
} |
Familiarity Increases Processing Speed in the Visual System.
Familiarity with a stimulus leads to an attenuated neural response to the stimulus. Alongside this attenuation, recent studies have also observed a truncation of stimulus-evoked activity for familiar visual input. One proposed function of this truncation is to rapidly put neurons in a state of readiness to respond to new input. Here, we examined this hypothesis by presenting human participants with target stimuli that were embedded in rapid streams of familiar or novel distractor stimuli at different speeds of presentation, while recording brain activity using magnetoencephalography and measuring behavioral performance. We investigated the temporal and spatial dynamics of signal truncation and whether this phenomenon bears relationship to participants' ability to categorize target items within a visual stream. Behaviorally, target categorization performance was markedly better when the target was embedded within familiar distractors, and this benefit became more pronounced with increasing speed of presentation. Familiar distractors showed a truncation of neural activity in the visual system. This truncation was strongest for the fastest presentation speeds and peaked in progressively more anterior cortical regions as presentation speeds became slower. Moreover, the neural response evoked by the target was stronger when this target was preceded by familiar distractors. Taken together, these findings demonstrate that item familiarity results in a truncated neural response, is associated with stronger processing of relevant target information, and leads to superior perceptual performance. | {
"pile_set_name": "PubMed Abstracts"
} |
Q:
why does the mv command in bash delete files?
running the following script to rename all .jpg files in the current folder works well sometimes, but it often deletes one or more files it is renaming. How would I write a script to rename files without deleting them in the process? This is running on Mac OSX 10.8 using GNU bash, version 3.2.48
this is an example file listing I would change for illustration:
original files
red.jpg
blue.jpg
green.jpg
renamed files if counter is set to 5
file_5.jpg
file_6.jpg
file_7.jpg
instead I get usually lose one or more files
#!/bin/bash
counter=5
for file in *.jpg; do
echo renaming "$file" to "file_${counter}.jpg";
mv "$file" "file_${counter}.jpg";
let "counter+=1";
done
** UPDATE **
it no longer seems to be deleting files, but the output is still not as expected. for example:
file_3.jpg
file_4.jpg
turns into
file_3.jpg
file_5.jpg
when counter is set to 4, when the expected output is
file_4.jpg
file_5.jpg
-
#!/bin/bash
counter=3
for file in *.jpg; do
if [[ -e file_${counter}.jpg ]] ; then
echo Skipping "$file", file exists.
else
echo renaming "$file" to "file_${counter}.jpg"
mv "$file" "file_${counter}.jpg"
fi
let "counter+=1"
done
A:
The problem is that some of the files already have names corresponding to the target names. For example, if there are files
file_1.jpg
file_7.jpg
and you start with counter=7, you overwrite file_7.jpg with file_1.jpg in the first step, and then rename it to file_8.jpg.
You can use mv -n to prevent clobbering (if supported), or test for existence before running the command
if [[ -e file_${counter}.jpg ]] ; then
echo Skipping "$file", file exists.
else
mv "$file" "file_${counter}.jpg"
fi
| {
"pile_set_name": "StackExchange"
} |
Cardinals Trio Gets Set For Arbitration
Submitted by jcovington on Mon, 01/13/2014 - 8:30am
A trio of Cardinals are preparing for the salary arbitration process this week. Outfielders Jon Jay and Peter Bourjos and infielder Daniel Descalso will file their desired salary figures tomorrow. Arbitration cases will be held in early February.
LOCAL WEATHER
ATHLETE OF THE WEEK
The KLPW Radio Athlete of the Week is Gus Kleekamp with the Washington Post 218 Junior American Legion Baseball Team. Gus pitches, plays shortstop and bats third on the Junior Legion team that won the state championship in Blue Springs over the weekend. He posted the save in a 4-3 win over Festus in the title game. His batting average is .400 with 47-rbi and 47 runs scored. As a pitcher, he's 5-0 with an ERA of 1.631 and a WHIP of .961.
SPORTS CORNER
The Washington Seniors came back to life with a 14-2 route of Manchester Post 208 in the loser's bracket of the state tournament in Sedalia Friday afternoon. Matt Miller pitched a complete game for the win, as Washington improved to 35-4. The victory puts Post 218 in the championship game against Fike-Blue Springs today. | {
"pile_set_name": "Pile-CC"
} |
The movie Carol is nearing its premiere at Cannes film festival next month. The movie is based on the erotic novel by Patricia Highsmith called The Price of Salt. The movie is directed by Todd Haynes and is...Read More
Twilight fame Robert Pattinson and his fiancé FKA Twigs are all set for marriage but say that they are at the moment not ready to be parents yet. They do not want kids for some years even by...Read More
Benedict Cumberbatch has to hit the gym for his new role in the Marvel’s upcoming Doctor Strange movie. The 38-year actor who is famous for paying characters who uses more brain than brawn is currently busy preparing for...Read More | {
"pile_set_name": "Pile-CC"
} |
Broadband wireless is expected to be one of the main drivers of the telecommunications industry. There is a substantial increase in demand for broadband connectivity, with personal broadband being the key growth engine for mobile wireless broadband networks.
Communication in such networks is generally divided between access and backhaul. An access network is the air interface network providing traffic communication between mobile terminals (subscribers) and their associated access points (base stations), while a backhaul network is the air interface network providing traffic communication between the various base stations and a core network. The networks may be arranged to transfer data alone, as in Wi-Fi networks, or may be arranged for triple play services video, audio and data), typically WiMax (or other competitive technology, such as 3GPP-LTE). In conventional systems, the access network and the backhaul network each require their own separate transmission equipment, antennas, etc. at great cost to the operator.
One example of a conventional backhaul network is connecting wireless base stations to corresponding core mobile networks (ASN GateWay, AAA servers, etc). The choice of backhaul technology must take into account such parameters as capacity, cost and coverage. Base station backhaul typically is performed via wired infrastructure (e.g., E1/T1 leased lines), or via wireless Point-to-point (PTP) microwave links to each base station, which is expensive to deploy (equipment and installation). In particular, due to the direct, uninterrupted line-of-sight requirements of the wireless backhaul equipment, the backhaul components of conventional base stations require strategic deployment location on high and expensive towers.
Mobile WiMAX, as defined in IEEE Standard 802.16e-2005 Standardization for WiMAX, was originally designed to provide mobile broadband access for mobile devices, i.e., broadband wireless data-optimized technology, providing carrier-grade triple play services using a variety of user devices (such as laptops, PDAs, handheld devices, smart phones, etc.). A complete mobile WiMAX Radio Access Network (RAN) requires deployment of massive infrastructure, including base station sites with high towers, base station equipment, antennas, and a separate backhaul network, as described above.
The traditional approach for mobile WiMAX network infrastructure deployment is similar to that of cellular phone networks. The network is based on macro-cell deployment, that is, the base stations, radios and antennas are installed on top of high towers, transmitting at high power, so as to maximize the base station coverage area. In order to optimize the cost, the goal is to minimize the number of sites. This can be achieved by deploying more powerful base station equipment for increasing the cell range (e.g., high power radios, multiple radios on each sector with smart antenna techniques), resulting in more expensive base station equipment. However, for a broadband wireless network deployment, this approach is adequate mainly for the coverage phase, when a relatively small number of subscribers share the cell capacity. As the cell coverage area is large, covering a large number of potential subscribers, additional subscribers in each area can rapidly be blocked due to limited base-station capacity.
One proposal for increasing the traffic capacity of the base station, while not greatly increasing the interference caused with neighboring cells, is to use several directional antennae on a base station, each pointing in a different direction. In this way, it is possible to “sectorize” the base station so that several different sectors are served from the same location. (In any given direction, only a small number of frequencies are utilized). However, directional antennas are relatively expensive.
There are also known outdoor Wi-Fi networks, deployed mainly according to outdoor Wi-Fi mesh technology. The typical Wi-Fi setup contains one or more Access Points (APs), which is the equivalent terminology to Base Station in WiMax, having relatively limited range, deployed along telephone poles, street poles, electricity poles and rooftops. Due to the access point unit's smaller coverage range, a large number of access point units are required to cover a given area. Conventional outdoor Wi-Fi access point units require costly power amplifiers in each Wi-Fi AP unit to extend the coverage range. In addition, conventional Wi-Fi networks operate only on unlicensed bands and suffer from severe interference and difficult radio-planning issues.
Furthermore, in the micro/pico-cell deployment approach of conventional Wi-Fi-mesh networks, due to multiple access point nodes in the network, backhauling becomes more complicated and costly. Backhauling each node via wired lines (E1/T1 or DSL) is impractical in a dense deployment of nodes. On the other hand, backhauling each node via traditional wireless PTP microwave links is expensive due to costly equipment and installation costs and not feasible to deploy on telephone poles, street poles, electricity poles, etc. In Wi-Fi, like in WiMAX, PTP microwave links require high towers to achieve a clear line-of-sight between nodes. In addition, when the network load is increased, the backhaul network losses drastically degrade the overall network performance (capacity and latency).
In traditional Point-to-Point (PTP) microwave backhaul operating in licensed bands or using unlicensed bands, OFDM (Orthogonal Frequency Division Multiplexing) or single carrier technology (constant power with a fixed modulation scheme) are typically employed. In OFDM, the channel bandwidth is divided into multiple concurrent parallel transmissions on several frequencies. However, during each time slot, there must be transmission over every frequency in the bandwidth. Thus, there is no granulation to permit correction of local interference, and, if there is a problem with transmission on one frequency, the entire transmission can be lost due to lack of frequency diversity, so the Signal to Noise Ratio (SNR) of a link (between two base stations) falls on the entire link.
Consequently, there is a long felt need for a wireless mobile broadband network that is relatively low in cost and provides an in-band backhaul network having interference mitigation. In particular, it would be useful to have such a network with improved PTP communication having high frequency diversity, variable modulation and coding, MIMO and dynamically adapted Beam Forming, according to the instantaneous link conditions. | {
"pile_set_name": "USPTO Backgrounds"
} |
Q:
Can't ping LAN machines while on wired connection
I have weird situation where a single machine on my home network can't access another. The network is provided by TP-Link WR841ND router to following machines:
A - 192.168.1.117 - Win8.1 machine, wired connection,
B - 192.168.1.200 - Ubuntu 12.04 server machine, wired connection,
C - 192.168.1.111 - Macbook, wireless connection,
D - 192.168.1.210 - Raspberry Pi, wireless connection.
The problem is that A and B can't ping each other, both with Destination host unreachable error.
A can ping C and D.
B can ping C and D.
C can ping A, B, D.
D can ping A, B, C.
If I take wireless dongle from D and use it on A, everything suddenly works - it's only when both A and B are connected via wired connection the problems arise.
arp -a on box A doesn't list B:
Interface: 192.168.1.117 --- 0xa
Internet Address Physical Address Type
192.168.1.1 *mac-address* dynamic
192.168.1.111 *mac-address* dynamic
192.168.1.210 *mac-address* dynamic
arp -a on box B lists A, but with <incomplete> where mac addresses of other devices are:
A (192.168.1.117) at <incomplete> on eth0
C (192.168.1.111) at *mac-address* [ether] on eth0
router (192.168.1.1) at *mac-address* [ether] on eth0
D (192.168.1.210) at *mac-address* [ether] on eth0
arp -a on box C lists everything:
router (192.168.1.1) at *mac-address* on en0 ifscope [ethernet]
A (192.168.1.117) at *mac-address* on en0 ifscope [ethernet]
B (192.168.1.200) at *mac-address* on en0 ifscope [ethernet]
D (192.168.1.210) at *mac-address* on en0 ifscope [ethernet]
The router is running DD-WRT v24-sp2 (06/23/14) firmware. Resetting factory settings didn't help, neither did disabling SPI firewall, toggling AP isolation on or off, or poking other buttons in frustration.
Any suggestions?
A:
It turned out to be bug in DD-WRT router firmware. Appears that this old bug is back in builds dated after 29.03.2014
| {
"pile_set_name": "StackExchange"
} |
Helicobacter pylori FlhB processing-deficient variants affect flagellar assembly but not flagellar gene expression.
Regulation of the Helicobacter pylori flagellar gene cascade involves the transcription factors sigma(54) (RpoN), employed for expression of genes required midway through flagellar assembly, and sigma(28) (FliA), required for expression of late genes. Previous studies revealed that mutations in genes encoding components of the flagellar protein export apparatus block expression of the H. pylori RpoN and FliA regulons. FlhB is a membrane-bound component of the export apparatus that possesses a large cytoplasmic domain (FlhB(C)). The hook length control protein FliK interacts with FlhB(C) to modulate the substrate specificity of the export apparatus. FlhB(C) undergoes autocleavage as part of the switch in substrate specificity. Consistent with previous reports, deletion of flhB in H. pylori interfered with expression of RpoN-dependent reporter genes, while deletion of fliK stimulated expression of these reporter genes. In the DeltaflhB mutant, disrupting fliK did not restore expression of RpoN-dependent reporter genes, suggesting that the inhibitory effect of the DeltaflhB mutation is not due to the inability to export FliK. Amino acid substitutions (N265A and P266G) at the putative autocleavage site of H. pylori FlhB prevented processing of FlhB and export of filament-type substrates. The FlhB variants supported wild-type expression of RpoN- and FliA-dependent reporter genes. In the strain producing FlhB(N265A), expression of RpoN- and FliA-dependent reporter genes was inhibited when fliK was disrupted. In contrast, expression of these reporter genes was unaffected or slightly stimulated when fliK was disrupted in the strain producing FlhB(P266G). H. pylori HP1575 (FlhX) shares homology with the C-terminal portion of FlhB(C) (FlhB(CC)) and can substitute for FlhB(CC) in flagellar assembly. Disrupting flhX inhibited expression of a flaB reporter gene in the wild-type but not in the DeltafliK mutant or strains producing FlhB variants, suggesting a role for FlhX or FlhB(CC) in normal expression of the RpoN regulon. Taken together, these data indicate that the mechanism by which the flagellar protein export apparatus exerts control over the H. pylori RpoN regulon is complex and involves more than simply switching substrate specificity of the flagellar protein export apparatus. | {
"pile_set_name": "PubMed Abstracts"
} |
Q:
Do compiled PHP scripts exist?
I am wondering if anyone has used or read about PHP scripts compiled as a .so extension for Apache... Thing is I think I remember reading about it somewhere but dont know if such a thing exists.
This looks promising, but incomplete and abandoned: http://phpcompiler.org/
Im interested because i think it could improve performance... Perhaps someone could point out a framework or apache extension that does this.
Thanks!!
A:
They do exist. There's HipHop Compiler for PHP by Facebook.
I don't know if it works with Apache, though.
You may want to take a look: http://developers.facebook.com/blog/post/358
Github repository: http://github.com/facebook/hiphop-php
A:
If you want to improve the performance of your PHP scripts in this way, you should try something like Zend Accelerator. It keeps the bytecode around so it doesn't have to be recompiled on every request.
A:
Im interested because i think it could improve performance
This is a very loaded question. Yes, if you are handling more than a million hits per hour, then there are very real benefits in compiling PHP (see other answers about HipHop). But if you really meant to ask "how do I improve the performance of my website" then that's probably the last answer anyone should give you.
If you're objective is to make your site go faster, then you first need to establish methods of capturing the time it takes to service a request (preferably seperating network and database time from webserver time), and for capturing page turn times (i.e. the time it takes to load all the content on a page) then look at stuff like:
browser side caching
server side caching
opcode caching
query optimization
HTTP compression
OS and network tuning
etc.
C.
| {
"pile_set_name": "StackExchange"
} |
Effect of culture conditions on the resistance of Pseudomonas aeruginosa biofilms to disinfecting agents.
The relationship between the environmental conditions of biofilm formation and resistance to disinfectants was studied. Anti-biofilm assays were performed against biofilms grown at 20, 30 and 37°C on stainless steel and polycarbonate, over 24 and 48 h. A rise in growth temperature increased the resistance of 24 h biofilms to disinfectants containing didecyldimethylammonium chloride and decreased it to a disinfectant containing alkyldimethylbenzylammonium chloride. The increase in growth temperature coupled with an incubation time of 24 h promoted increases in both matrix production and the membrane rigidity of sessile cells. An increase in incubation time also increased both matrix production and the membrane rigidity of sessile cells. Such phenomena resulted in an increased resistance to disinfectants of biofilms grown at 20 and 30°C. The resistance of 48 h biofilms to disinfectants decreased with an increase in growth temperature despite the increase in matrix production and the membrane rigidity of sessile cells. | {
"pile_set_name": "PubMed Abstracts"
} |
Importance and relevance of melatonin to human biological rhythms.
The pineal hormone melatonin is a remarkable molecule, with a conserved time-keeping function across species. It is extensively used as a self-administered remedy for sleep disturbance in countries where it is freely available, and to some extent when it is available on prescription, as in the UK. In some circumstances, notably free-running sleep disorder of the blind, it is the treatment of choice. It is also the marker rhythm of choice for the determination of circadian phase and period. This review outlines the current state of knowledge within a physiological perspective with emphasis on human biological rhythms. | {
"pile_set_name": "PubMed Abstracts"
} |
Hepatitis B core-related antigen levels are associated with response to entecavir and peginterferon add-on therapy in hepatitis B e antigen-positive chronic hepatitis B patients.
Hepatitis B core-related antigen (HBcrAg), a new serum marker, may be useful in monitoring chronic hepatitis B infection. HBcrAg was measured in 175 hepatitis B e antigen-positive patients treated with entecavir (ETV) with or without peginterferon (PEG-IFN) add-on therapy. Decline in HBcrAg was stronger in patients with vs. without combined response (ETV: -3.22 vs. -1.71 log U/mL, p <0.001; PEG-IFN add-on: -3.16 vs. -1.83 IU/mL, p <0.001) and in patients with vs. without hepatitis B surface antigen (HBsAg) response (ETV: -2.60 vs. -1.74 log U/mL, p <0.001; PEG-IFN add-on: -2.38 vs. -2.15 log U/mL, p = 0.31). HBcrAg was associated with combined response (adjusted odds ratio 0.3, 95% confidence interval 0.2-0.5, p <0.001), but was not superior to quantitative HBsAg (qHBsAg). | {
"pile_set_name": "PubMed Abstracts"
} |
Midnight: A Gangster Love Story
Midnight: A Gangster Love Story originally scheduled to be published October 14, 2008, is a novel by Sister Souljah that was published November 4, 2008, by Atria/Simon and Schuster. It is a prequel of The Coldest Winter Ever (1999), the novel that spawned the contemporary street literature movement. It follows a young Black Sudanese Muslim immigrant in Brooklyn with whom Winter Santiaga associated before she was sent to prison.
Characters
Midnight, the narrator and title character, is a 14-year-old Black Sudanese immigrant. He learns about the struggles that occur in the US. He proceeds to criticize the way that modern African Americans act in contrast to the way he and the men in Sudan behave and, in contrast, they have loose behavior. He also learns to find love and trains in Ninjutsu so that he can protect the people whom he loves and cares for.
Umma, Midnight's and Naja's mother, is content with the way woman act in her country and is trying to make a notable life for her two children since their move to the United States by founding a business through which she designs and sells elaborate traditional garments.
Naja, Umma’s daughter, is Midnight's 7-year-old sister. Midnight and Umma try to protect her from the world at large.
Akemi, a 16-year-old Japanese girl who lives in Queens where she is working for her uncle while in America on an art fellowship from Japan. Akemi speaks Japanese, Mandarin, and Korean, but she is slowly learning English. An art prodigy, she attends college-level classes at Pratt Institute. She and Midnight love each other romantically.
Ameer, described as one of Midnight’s close friends, is a 15-year-old Five Percenter who is mostly interested in girls. Ameer and Midnight fight frequently in a playful way. After a street fight between the two characters ends, Midnight explains his and Akemi's relationship.
Chris, another of Midnight's close friends, plays basketball for money in a hustlers’ league, and lives with his mother and strict, protective father.
Marty Bookbinder, the owner of a bookstore with whom Midnight plays chess and is offered sage advice and life lessons.
Plot
Midnight is born into a prominent Islamic Black Sudanese family in which he enjoys a life of comfort, confidence, and protection. His father provides him with a veil of privilege and deep, devoted love, but he never hides the truth about the fierce challenges of the world outside of his estate. In the mid 1980s, his father abandons the family, disappears, and is never heard from again. Just before his disappearance, he instructs Midnight and his immediate family to move to the United States. Midnight, his mother, and his sister eventually settle in project housing in the borough of Brooklyn in New York City. They are repulsed by American culture and try to live as comfortably as possible without fully engaging with their new home.
In the streets of Brooklyn, a young Midnight uses his Islamic mind-set and African intelligence to protect the ones he loves, build a business, reclaim his wealth and status, and remain true to his beliefs.
Over the course of four years, Midnight eschews traditional school and eventually enrolls into a Japanese martial-arts dojo, where he trains to be as nimble as a Japanese ninja. When a strange man professes his attraction to Umma, Midnight hunts him down and kills him in Prospect Park—a perfect murder that the police never solve. He also learns how to play basketball and is one of the star players in a hustlers’ league, where he meets his two closest friends, Ameer and Chris. He is also obsessed with protecting his family and procures a stash of weapons for protection. He frequents a small bookstore where he plays regular games of chess with its owner. However, he is extremely guarded and no one outside of his immediate family ever finds out whom he really is or even what his real name is.
Later, Midnight meets a young woman named Akemi, who is an art prodigy from Japan who takes advanced-placement classes at Pratt Institute. Eventually, despite neither of them being able to understand each other’s language, Midnight and Akemi fall in love and decide to marry. Midnight tries to manage his life with Akemi and look out for his family and hang out with his friends while managing his family's newly opened business. He comes to terms with struggles that occur from day to day.
Umma and Naja accept Midnight and Akemi’s decision joyously. When Akemi’s father learns of the marriage, however, he does not approve of the union and takes her back to Japan. In the sequel, Midnight travels to Japan to try to take her back home.
References
External links
Simon & Schuster
Category:Novels by Sister Souljah
Category:2008 American novels
Category:Urban fiction
Category:Brooklyn in fiction
Category:Novels set in New York City | {
"pile_set_name": "Wikipedia (en)"
} |
$219,000
FOR SALE206 John Street, Maryborough
Property ID:61817730
Bedrooms:2
Bathrooms:1
Property type:HOUSE
Land size:870 Metres²
Building size:
Garage:1
Listing type:FOR SALE
CHARACTER & CHARM
This delightful award winning home is full of old world charm. The traditional features on offer are from the (Circa 1936) and are second to none. A renovator will appreciate this unique find and enjoy adding their own touches to the home with the minor renovations required.
Some of the many features include ornate plaster ceilings, led lighting, French doors, T & G walls, bay windows, fret work, and air conditioning.
There is a timber garage at the rear of the block and good side access is available.
The property is situated on a fully fenced 870m2 allotment within walking distance to the CBD, schools, park land, and restaurants.
The home is meeting the market and is listed for sale at a figure of $219,000
For further details please contact the office.
Contact
Email To A Friend
Resources
We would like to thank you and Wal for all your efforts in negotiating and seeing the sale through to settlement in such a supportive and professional manner. Kind Regards Rhonda & Alan
- Rhonda & Alan
We are so happy with Wal Pavey Real Estate. When we came to Maryborough over 10 years ago we purchased a property from them and their knowledge and information was great. Wishing to sell our property we contacted these agents again and to our surprise they were able to gain a contract for the home in a couple of days and now the contract is unconditional. Would recommend this firm to any buyer or seller in the area
- Glenda
Cindy Pavey of Wal Pavey Real Estate was engaged to sell a property for Margaret White at 204 Tooley Street in Maryborough in late 2019. In less than 2 weeks she had a contract and after some negotiation and building inspections, the property went unconditional. This was not an easy property to sell and it had been on the market with another agent for over 2 years. Then Cindy managed to find a rental property for Margaret in a very tight rental market for the Maryborough area at this time. I have no hesitation in recommending Cindy Pavey to anyone considering selling or buying. For clarification of the above my phone number is included.
Signed Jim & Margaret | {
"pile_set_name": "Pile-CC"
} |
On Oct. 23, Denise Grady, health writer for The New York Times, wrote an article about a new in-utero surgical technique to correct fetal spina bifida — a condition in which the spinal column does not fuse, leaving the spinal cord exposed. Children born with spina bifida are unable to walk and can suffer a host of other serious disabilities. Surgeons have been operating on gestating children to ameliorate spina bifida for about 20 years, with mixed results. But this new method is fetoscopic; it does not require opening the uterus and removing the developing fetus. Instead, tools are inserted into the uterus through a tiny incision, and surgery is performed guided by a tiny lighted camera and images projected on a video screen.
Grady watches the surgery — which took place last month at a Houston hospital — and tone of her piece is hopeful; even a bit awestruck. Describing the gestating infant being operated on — at only 24 weeks — she writes, "The patient, still inside his mother's womb, came into focus ... Fingers, toes, the soles of his feet — all exquisite, all perfectly formed." | {
"pile_set_name": "OpenWebText2"
} |
Summary: an AU taking place in the ep "Faith" - what these two do on the planet.
warning: this is probably an offshoot of my series, rather than something that takes place in the show over season 1. or maybe it tucks back into the series, I don't know.~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
"Rush, what the hell're you doing?" Young asked, after a dash from the just-now-locked door to the shuttle to the nearest comm room.
"Playing poker, it seems, Colonel," Rush said, sitting in the pilot seat. He had been standing in the corridor, perfectly ready to ask Col. Young if he was really going down to the planet, when Lt James had walked up to him and past him, not even slowing her walking pace when she grabbed him by one shoulder...and half pulled, half led him to the shuttle.
"Do not disengage from Destiny. Do you hear me?"
"Colonel, what's the penalty for insubordination?" Rush asked. "Now compare that to the penalty of starvation."
"What?" Young and Eli both asked.
"I trust things will become clearer," Rush said, and, listening, Eli wondered who he was talking to just now.
~~~PLANETSIDE:
"I thought Colonel Young was coming," Scott says.
"As did I," Rush says. "But, as you can see, plans have changed."
"Why are you here?" TJ asked them.
"Well, we're going to load up the shuttle with food and water. And then we're going to stay here."
"For how long?"
"As long as everyone else does," Rush said. "I'm sure Destiny will be fine without me. After all, what have I ever done to fix her?"
That generated murmurs and sped up everyone converging on this point.
"You can't do that," TJ said.
Vanessa grinned to herself: Tell Rush he can't do something, and he takes it personally.
"Why not?" Rush asked TJ.
Like I knew he would, Vanessa thought to herself.
"This planet is habitable for most of the year. I'm sure I can devise a way for us to survive when this planet's orbit takes it beyond the freezing point of water."
"It won't come to that," said Caine. "By that time, the aliens who built this world, will come back."
"Maybe," Rush said.
"They will. They made this world for us. They can help us get home."
"Aliens made the planet?" Vanessa asked him.
"Yes," he said, a little puzzled - he'd thought everyone had been briefed on that by now.
"And that makes them good guys?"
"An advanced alien civilization has no need to go to war."
2nd Lt James frowned, and she could see a few other similar faces among those assembled. "I'm going to guess you haven't been with the Stargate Program very long."
"Almost a year, actually," Caine said.
"Then you never met the Goa'uld or the Ori," Vanessa said, seeing Greer and Volker nod.
"On the other hand," Vanessa said, "maybe you're right. Maybe we should stay here and see what these aliens want from us in return for the planet or the ride home. All I ask is I get a window seat," and walked to one of the tents.
The shuttle was up and launching, fully stocked with people and food and water, within the hour. | {
"pile_set_name": "Pile-CC"
} |
Jimmy Savo
Jimmy Savo (1895 – September 5, 1960) was an American Vaudeville, Broadway, nightclub, film and television performer, comedian, juggler, and mime artist.
Life
Born in New York City as James Vincent Savo on July 31, 1892, Savo began his career as a juggler in amateur contests and went on to the burlesque circuit and then Broadway. In 1938, he originated the role of "Dromio of Syracuse" in The Boys from Syracuse.
Savo also starred in "Once In A Blue Moon," (1935) written by Ben Hecht and Charles Macarthur. The film was not a success, costing Paramount pictures $350,000.
In 1942 Isidore Herk and the Shubert brothers co-produced a Broadway show called Wine, Women and Song, starring Jimmy Savo and Margie Hart.
The show was advertised as a combination of vaudeville, burlesque and Broadway revue, and ran for seven weeks.
The revue included striptease, which shocked some of the audiences.
Wine, Women and Song was closed by court order in December 1942.
Savo was the author of two books: Little World, Hello! (1947) and I Bow to the Stones; Memories of a New York Childhood (1963).
He died in Terni, Italy in 1960.
References
Further reading
"Jimmy Savo Dead; Comedian was 64" The New York Times September 7, 1960
"Jimmy Savo (New York 31 luglio 1892 - Guardea 3 settembre 1960); sposato con Frances Victoria Browder, divorziato nel 1935, figli: Jimmy Vincent Savo Junior, sposato in seconde nozze con Farina Lina, Italia, Guardea (Terni), senza figli.
"Jimmy Savo; di Famiglia Lucana originaria di Stigliano (Matera) al "secolo" Vincenzo Rocco Sava, abitò con Farina Lina a Guardea (Terni) Italia nel Castello del Poggio e ad Amelia (Terni) Italia in Via Marcheggiani n. 26. Oggi abitazione "Della Rosa" Amelia (Terni). Referenze, fotografie e note in: www.grupporicercafotografica.it/jimmysavo.htm.
Cullen, Frank, Florence Hackman, and Donald McNeilly. Vaudeville, Old & New: An Encyclopedia of Variety Performers in America. New York: Routledge, 2007. Pg. 993
''Schmucks with Underwoods," Max Wilk, (C) 2004 Applause Theatre and Cinema books
External links
Jimmy Savo at American Museum of Vaudeville.com
Jimmy Savo http://www.grupporicercafotografica.it/jimmysavo.htm
Jimmy Savo http://www.jimmysavo.it
Jimmy Savo http://jimmysavo.altervista.org
Category:Vaudeville performers
Category:American mimes
Category:American male film actors
Category:American male silent film actors
Category:American male comedians
Category:American male musical theatre actors
Category:1895 births
Category:1960 deaths
Category:Jugglers
Category:20th-century American male actors
Category:20th-century American comedians
Category:20th-century American singers
Category:20th-century male singers | {
"pile_set_name": "Wikipedia (en)"
} |
Can Adults With Autism Spectrum Disorder Drive?
Autism spectrum disorder (ASD) does not stop adults with the disorder from driving but may make speed and lane management difficult, according to a new study.
Can Adults With Autism Spectrum Disorder Drive?
But licensed drivers with ASD have similar basic driving skills as their TD peers - even under more demanding conditions, according to the study by researchers at Drexel University, Philadelphia. "We hope our findings will help in developing targeted approaches to help teens and young adults with ASD to become safe drivers, helping to promote their independence in many aspects of life," comments lead author Kristina Elise Patrick, PhD, now at Nationwide Children's Hospital, Columbus, Ohio.
‘Drivers with autism spectrum disorder have similar basic driving skills as their peers but have difficulty in speed and lane management.’
Less-Experienced Drivers with ASD Have More Problems with Driving Skills
The study included two matched groups of young drivers, aged 16 to 26 years: 50 with autism spectrum disorder (ASD) and 50 with TD. None of the participants had been diagnosed with intellectual disability; the ASD and TD groups were similar in terms of age, gender, driver's license status, and IQ.
All participants underwent a structured driving assessment using a virtual reality driving simulator. During the simulation, the driving tasks become progressively more challenging, with added distractions and more complex driving conditions. The two groups were compared for basic driving skills, such as speed and lane positioning.
The two groups had similar performance in terms of maintaining the speed limit. However, drivers with ASD showed increased variability in speed and lane management, compared to drivers in the TD group. These differences suggested "difficulty with self-monitoring and regulation of pedal pressure and steering wheel control," Dr. Patrick and coauthors write.
The differences between the drivers with ASD versus TD were more pronounced in more challenging driving environments. This was so not only in more complex driving conditions, such adjusting to a change in speed limit or construction zone; but also when engaging in secondary, potentially distracting tasks, such as tuning the radio or engaging in social conversation.
However, the differences in performance for drivers with ASD depended on driver's license status. Among unlicensed drivers, the ASD group had greater variability in speed and/or lane positioning, compared to the TD group. But among those who had their driver's license, there were no significant differences between the drivers with ASD versus TD. For many tasks, there was also similar performance for drivers with ASD and TD who had their learner's permit.
Affecting approximately 1 in 68 children, ASD is a common neuro-developmental condition. With early recognition and access to effective treatments and support, many young people with ASD have educational, occupational, and social opportunities similar to those of their TD peers. The ability to drive is a developmental milestone in American society, and an important part of independent functioning.
Studies suggest that only about one-third of teens with ASD have their driver's license - perhaps due to concerns about their ability to drive safely. The new driving simulator study is one of the first objective assessments of driving ability in teens and young adults with ASD, compared to young people with TD.
"Our findings suggest that unlicensed young adults with ASD may have more difficulty than their peers developing basic driving skills," Dr. Patrick and coauthors write. "That said, those individuals with ASD who do acquire driver's licenses may demonstrate comparable skills to TD drivers during most tasks."
Dr. Patrick and colleagues are working on further studies of variables that may affect driving performance in young adults with ASD, and whether difficulty with basic driving skills translates to more overt driving errors. The researchers conclude, "Individually tailored driving interventions with a focus on graduated exposure to increasingly complex environments may be beneficial for individuals with ASD, particularly in the early stages of driver training."
The complete study is published in the Journal Developmental & Behavioral Pediatrics, the official journal of the Society for Developmental and Behavioral Pediatrics.
Your comments are automatically posted once they are submitted. All comments are however constantly reviewed for spam and irrelevant material (such as product or personal advertisements, email addresses, telephone numbers and website address). Such insertions do not conform to our policy and 'Terms of Use' and are either deleted or edited and republished.Please keep your comments brief and relevant.This section may also have questions seeking help. If you have the information you are welcome to respond, but please ensure that the information so provided is genuine and not misleading.
Disclaimer - All information and content on this site are for information and educational purposes only. The information should not be used for either diagnosis or treatment or both for any health related problem or disease. Always seek the advice of a qualified physician for medical diagnosis and treatment.Full Disclaimer | {
"pile_set_name": "Pile-CC"
} |
top and tail
top and tail
1. noun The act of quickly washing the head and buttocks of a baby or small child. Primarily heard in UK. We need to remember to start doing top and tail each evening before we put Samantha to bed. The GP said the cradle cap was because she's not getting washed often enough.
2. verb To quickly wash the head and buttocks of a baby or small child. Primarily heard in UK. It's too late for a bath, so just top and tail him after you brush his teeth.
3. verb To cut off the top and bottom ends of a fruit or vegetable as part of its preparation for a meal. Primarily heard in UK. Next, top and tail the cucumbers and slice them into thin spears, removing the seedy flesh from the centre.
All content on this website, including dictionary, thesaurus, literature, geography, and other reference data is for informational purposes only. This information should not be considered complete, up to date, and is not intended to be used in place of a visit, consultation, or advice of a legal, medical, or any other professional. | {
"pile_set_name": "Pile-CC"
} |
Share this Story
Ward Churchill Case Heads to Colorado Supreme Court
ICTMN Staff
5/29/11
Ward Churchill
Embattled former University of Colorado (CU) professor Ward Churchill’s civil rights case will be reviewed by the Colorado Supreme Court.
High court scrutiny will be afforded to the issue of whether CU’s investigation of Churchill’s scholarship was an “adverse employment action” under federal civil rights law when, after the investigation’s conclusion he was fired for “research misconduct.”
“It’s a very hopeful sign for the First Amendment, for academic freedom, and for tenured professors,” David Lane, Churchill’s attorney, said.
Churchill and a District Court jury—whose verdict was tossed out by the lower court judge—contended he was fired in 2007 in violation of free speech rights after attention was drawn to a post-9/11 essay he wrote in which he referred to some World Trade Center workers as “little Eichmanns” as part of a critique of U.S. foreign policy.
The Colorado Supreme Court will also decide whether granting quasi-judicial immunity to CU regents who fired Churchill, a tenured professor, and the subsequent denial of his reinstatement or other remedies are actions consistent with civil rights law.
Churchill earlier was unsuccessful in an attempt at a reversal of the lower court judge’s decision to dismiss a jury’s retaliatory firing verdict and then to deny him reinstatement to his former faculty position because, the judge determined, CU officials were immune from liability.
Then, last November, the Colorado Court of Appeals ruled that his academic freedom “did not include the right to commit research misconduct that was specifically proscribed” by CU’s policies and enforced by shared CU/faculty governance in what the court determined was not an adverse action.
Churchill, who wrote extensively on Native issues, was fired from CU’s ethnic studies department after his online essay seemed to blame all 9/11 victims personally for federal policies that preceded the 2001 attack and, although he subsequently attempted to clarify what he meant, a political firestorm ensued.
A former Colorado governor and other politicians, CU regents, talk show hosts, and assorted pundits called for him to be fired, and were “falling all over themselves to talk to the national media and calling for his dismissal,” Lane said at the time, vowing to go to the U.S. Supreme Court, if necessary.
CU decided that his post-9/11 essay enjoyed free-speech protections but that simultaneously raised allegations of research misconduct had to be addressed “just as it should address alleged sexual harassment, sanctionable criminal activity, or other wrongdoings within its purview,” CU said, and Churchill was fired after the review.
Churchill, in turn, charged that CU selectively enforced research misconduct policies “in retaliation for his exercise of free speech.”
“As it stands right now, if a university fires a professor for protected speech, the court will turn a deaf ear—hopefully the Colorado Supreme Court will reverse that,” Lane said after the state Supreme Court agreed to review Churchill’s case.
Legal observers felt it was possible the state’s high court might accept Churchill’s request for review because the issue of whether an investigation alone constituted an adverse employment action had not been resolved in the U.S. Supreme Court.
The date for hearing has not been set for the Colorado Supreme Court’s review of the issues presented by Churchill, who was not immediately available for comment.
You need to be logged in in order to post commentsPlease use the log in option at the bottom of this page | {
"pile_set_name": "Pile-CC"
} |
" Mother." " Good morning, darling." "I have a feeling you're trying to tell me something." "Those were in you-know-who's briefcase." " So?" " Well, don't you care if he carries pictures of other women?" "Mother, in the advertising business, other women are merely tools of the trade." " Oh, blind faith is unbecoming to you, Samantha." "Don't you understand?" "I trust Darrin." "You wouldn't turn a child lose in a candy store, would you?" "Darrin is not a child." "Well, he's only human." "Isn't that the excuse they always make for themselves, "I'm only human"?" "They know their limitations better than we do." "Well, I don't think of Darrin as being merely human." "I think of him as being a cut above the ordinary mortal man." "How can a witch of mine be so naive?" "Mother, will you please go away." "Very well, very well, I'm leaving." "But remember, Samantha no mortal pulls the wool over a witch's eyes while I'm around." "What are these doing here?" "Thought I left them in my briefcase." "You better eat your breakfast." "You'll be late." "I've been looking at girls for weeks." "Yes, I suppose that could get tiring after a while." "You're not kidding." "Which one do you like best?" " For what?" " Miss Jasmine, the perfume account." "Oh, yes." "Of course." "Well, let's see, now." "This one has lovely eyes." "And this one has a beautiful mouth." "This one has a great figure." "Gee, I don't know." "Why don't you cut out the best piece of each and paste them together like I used to do." "With paper dolls." "Look, I'm serious, Sam." "The campaign starts tomorrow, and we haven't picked a Miss Jasmine." "Incidentally, we have to forget about having lunch together today." " How about tomorrow?" " Well, all right." "As long as you promise to have lunch alone today and not enjoy it." "I'll do better than that." "I'll have lunch with Larry Tate and really be miserable." "Better get going." "You better get going." "Okay." "But remember, you threw me out." " So, what do you think?" " Marvellous." "Incredible." "Some of the most gorgeous creatures I ever laid eyes on, but I still haven't seen that je ne sais quoi that ethereal quality we need in a Miss Jasmine." "Courage, old friend." "Don't lose faith, we'll find her." "I know that." "I was just thinking about going home to Louise tonight." "I don't know, after a week of looking at these, it seems pointless somehow." " Now, Larry, you've got a lovely wife." " I suppose so." "If you'll excuse me, Darrin, I'm going out to try and wipe out the memory of all this." "I never could stand too much of a good thing." " Yes?" " I hoped you'd say that." " I beg your pardon?" " Aren't you looking for a Miss Jasmine?" "I was." "I mean, we are." " Won't you sit down, Miss...?" " Janine Fleur." "Thank you." "Have you done much modelling, Miss Fleur?" "I'm sure I could be everything you want in a Miss Jasmine, that is." "You might." "Yes, you just might." "Hello, Larry?" "Can you come in here for a minute?" "Good." " Is something wrong?" " Wrong?" "No." "You may solve a very big problem for me, Miss Fleur." " Janine." " Well?" "Well..." "Well." "I'm thinking exactly what you're thinking, Larry." "I won't say anything if you won't." "You've been very quiet tonight." "You have a bad day at the office?" "Oh, it wasn't a bad day." "It wasn't a good day." "As a matter of fact, it wasn't a bad day." "Well, don't commit yourself." "Anything new on Miss Jasmine?" " We found one." " You did?" "Oh, that's marvellous." "What's she look like?" " Attractive." " Attractive?" "You said you needed something gorgeous." "Well, she's sort of gorgeous." " She's blond, I'll bet." " No, not really." "Well, what's she look like?" "Tall, straight nose, experienced." "Well, that could be Abraham Lincoln." "I said she was pretty." "You said she was attractive." "There's a difference." " What's her name?" " Janine Fleur." "Oh, sounds like perfume." " Does she look like she sounds?" " You could say that." "I haven't seen her." "What do you say?" " Yes." " Yes, what?" "She sounds like perfume, she looks like perfume she even smells like perfume." " You smelled her?" "No, of course not." "Not deliberately." "She's exactly what Larry and I have been looking for." "Well, that's wonderful." "Now, how would you like to go to the movies, eat popcorn and smooch?" "I would love to but I've got to work on some exploitation ideas." "He's very evasive." "That shows interest." "He is only interested in that woman because of business." "You'd better make it your business." "Did you notice that he kissed you on your forehead?" "The next thing you know, he'll be patting your hand." ""Notes on Jasmine campaign:" "Janine Fleur, measurements 37-23-37."" ""Adjectives to be used in copy describing her:" "Provocative, dazzling, ethereal." "Personally supervise photographs for campaign." "Get headshots featuring her large, soft, dark eyes." "Get night shots at beach." "Moonlight." "Janine holding perfume bottle in her long, slender fingers." "Should be irresistible in a bikini."" " What happened?" " You were having a nightmare." " Didn't seem like one." " I say it was." "I know a nightmare when I see one." "Go back to sleep, dear." " Well?" " I'd like to change her position a bit." "Figures." "Here, Janine, why don't you try your hand here, stroking the bear's nose." "Thank you." "There you go." "You keep moving her around, we'll be here all day." "I think we've got it now." "Hold it." " Thank you." "Is that lunch?" " Go ahead." "Lunch, Janine." "Oh, wonderful idea." "I'm starving." "Where shall we go?" "We?" "I'm afraid I can't." "I'm meeting my wife." "Well, I wouldn't ask you or interfere, except that it's..." " Well, never mind." " Well, what is it?" "Well, it's probably foolish, but I think you'd better get another Miss Jasmine." "Another Miss Jasmine?" "What for?" "Now, hold it." "I think we better talk about this." " But your lunch." " I'll cancel it." " Please don't do that because of me." " My wife will understand." "She knows that at the moment the most important thing is Jasmine Perfume." " Go and change, and I'll give her a call." " All right, I'll hurry." "Hello?" "Oh, hi, darling." "I was just leaving." "What?" "Oh, no, no." "I understand." "Yes, well, you go ahead." "I'll see you tonight." "Well, well, well." "All dressed up and nowhere to go." " I am going to have lunch with Darrin." " Really?" "One of these days when he's not too busy." " Oh, I understand, dear." " No, you don't." "You think my husband is taking another woman to lunch." " I haven't said a word." " Well, it's business." "Oh, yes, of course." "Well, I was going to suggest that perhaps we could have lunch together." "Oh, certainly." "You know where Darrin is so you're gonna bring me face to face with him to prove your point." " I never suggested it." " I won't." " Very well." " I'll tell you what I'll do." " What?" " I am going to take you there and bring you face to face with Darrin to prove my point." "Wait for me, Samantha." "Oh, isn't this delightful." "We must have a waiter." "Waiter." "Menu." "Thank you." " Mother, are you sure he's here?" " Quite sure." "Oh, they have Coquille St. Jacques." "They make it marvellously here." "Mother." "I don't believe it." "I'm sure I will." "Where is he?" "I know this is upsetting for you, darling but I'm not in the least surprised." "But, Mother, why?" "I thought he was happy with me." "It's the spirit of conquest." "It's a disease of mortal men." "Like chickenpox." "Just a moment." " That girl..." " I know how you feel, Samantha but I do think we ought to leave before they see us." "Now, Samantha!" "You're not going to create a scene!" "All right." "Come off it, Sara." "Dignity, Samantha, dignity." "Well, hello, Samantha." "My, it has been a long time, hasn't it." "Sara Baker." "I should've known." "She's one of us, Mother, although I hate to admit it." "Just what do you think you're doing with my husband?" "Your husband?" "Now, I heard you'd done something foolish but I never thought for a moment..." " You haven't answered my question." "Well, that must be obvious." "I'm Miss Jasmine." "Well, now, I must say I've had enormous respect for Darrin's taste up until now." "Now, just a moment, blithe spirit." "Watch your tone, my girl, you're speaking to my daughter." "Oh, really?" "Well, now, look who's suddenly so concerned." " What does that mean?" " Pay no attention to her." "You seem terribly solicitous for someone so anxious for me to test your mate's mettle." "Mother!" "If there's one thing I cannot abide, it's a stool pigeon." "What did you think you'd prove by siccing this broom rider on Darrin?" "Easy, Samantha." "Be careful what you say." "Well, you haven't proved a thing." "Even Sir Galahad wouldn't be safe with her." "That's better." "Now that this masquerade is over, I trust it won't be necessary to ask you again." "Stay away from Darrin, Sara." "Is that clear?" "Well, she certainly is sensitive, isn't she?" "Pity, I was just starting to enjoy myself." "I appreciate your efforts on my behalf, Sara Baker but now you'll do as my daughter asked." "You know how difficult it is for me to leave something unfinished, Endora." "Force yourself." "All of us at McMann Tate are behind you 100 percent to make you the best Miss Jasmine there ever was." " I want you to believe that." " I do believe you, Darrin and I won't think about leaving again." "You wouldn't want me to start something I couldn't finish?" "Of course not." "I want..." "Where did all the time go?" "We haven't even had our lunch." "We'd better get back." " We'll talk about this some other time." " Oh, yes, indeed." "Some other time." "Waiter." "Hello?" "Oh, hello, darling." "How are you?" "You're not?" "Yes, dear." "Business." "Miss Jasmine." "Oh, I understand." "No, I'm fine." "Yes, sweetheart." "See you later." " She won't give up, eh?" " That home-wrecking harpy." "Professional pride, I suppose." "She's not gonna get away with it." "I'm gonna tell Darrin that she's a witch." "I wouldn't try to convince him he's susceptible to witches, Samantha." "I never used one single spell on Darrin." "You may have a difficult time convincing him of that." "Mother, what am I going to do?" "You have no choice." "I guess not." "I suppose every woman has to face this at one time or another." "Darrin will just have to be on his own with no help from anyone." " Yes, but, darling..." " And so will I." " All finished?" " Almost." "How are things coming with Miss Jasmine?" "I think we're getting some good layouts." "Fine." "Well, I'll see you tomorrow." "Where you going?" " Home." " Do you have to?" " Yes." " Louise is waiting for you, I suppose." "Well, is it urgent that you go home right at this minute?" "Not if you have somewhere else for me to go." " I do have." " Where?" "Janine Fleur's apartment." " Really?" " With me." " Why?" " I've got business to take care of with Janine, and I'd rather not do it alone." "I brought Larry along to approve some of these changes you asked me to come over and make." "Yes, of course." "May I fix you both a drink?" " Yes, thank you." " No, thank you." "Just a little one." "Well, fine." "Larry, these television spots need a little..." "Larry." "Oh, yes." "They certainly do need a little." "Yes." " I was going to say "fixing."" " I'm not arguing with you." "There you are." "Well, here's to your very good health, Miss Fleur." " Of course." " Thank you." " Are they all right?" " Mine's wonderful." "I think I'll lay down and take a nap." "Meantime, I'll take care of Janine." "Isn't it getting crowded in here?" "Sara, I'm going to lay it right on the line with you." "I love my husband, and I also have a great deal of faith in him." "Oh, is that why you're here?" "Looking after him?" "He can take care of himself as long as you don't pull anything fancy." "I don't know what you're talking about." "Oh, of course not." "He was suddenly bitten by a tsetse fly." "Samoan lotus leaf." "Now, at least let him act of his own free will." "I thought you had more pride than that." "Believe me, Samantha, I have no need of help." "If I'm going to lose Darrin to something like you it's better that I find out now." "Remember what I said." "His own free will." "And go over the papers right away." "Is that all right with you, Larry?" " Oh, sure." " Why don't we sit over here." " The light's a bit better." " Oh, fine." "Come on over, Larry." "All right." "Yes, here we are." "Now, in this first set-up..." " Why don't you go on home, Larry." " I'd be glad to." "Two's company and three's a crowd." " Where you going, Larry?" " Home, I think." "Well, what for?" "I don't know, but I don't think it was my idea." " Well, wait for me, will you?" " Sure." "I think I need another drink." "All right, now, I think the dialogue that probably gives you the most trouble is on page three." " You're absolutely right." " It seems to me, if you said:" ""Jasmine introduces a new sensation" rather than "a new essence" that might make it easier." "Wouldn't you say so, Larry?" "Larry?" "That's the strangest thing I've ever seen." "He keeps going to..." " Kiss you." " What did you say?" "I said, I wanna kiss you more than anything else in the world." "Go ahead." "What in...?" "That wasn't funny, Samantha." "Well, I warned you." "Now, if you'll excuse me, I'd just as soon keep my husband alive." "Get out of here, or I'll..." "You'll what?" "You know what I'm capable of doing." "I'd say we were pretty evenly matched." "Sort of reduces this to the human level, doesn't it?" "How would you like a poke in the nose?" " I'm not a brawler." " I didn't think so." "Pardon the intrusion." " What did you do that for?" " I'm sorry, Darrin." "It slipped." "Never mind, I probably had it coming." " What happened to you?" " Nothing, where were you?" "I think I took another nap." " I feel great." " I'll see you tomorrow, Janine." "But, Darrin, we have things to talk about." "I don't mind breaking dinner dates with my wife for something important but there's nothing here that can't be fixed down at the office." " Are you coming, Larry?" " You run along." "You're absolutely right." "Samantha must be concerned about you." "Suit yourself." "All right." "Well, now, Miss Fleur, suppose we talk about your problems." "Now what?" "I realise that this is none of my business, Sara but Louise Tate happens to be a very dear friend." "Some other time." "My wife is waiting for me too." "Oh, yes, if you can't stay, I understand." "Then I wish you'd explain it to me." "Come in." " Hello, darling." " Hi, sweetheart." "This time I didn't take any chances." "I didn't phone, I just came right down." "I've got it written on my calendar in big red letters:" " "Lunch, my wife, urgent."" " Good." " Oh, is that Miss Jasmine?" " Yep, that's her." "Let's go, dear." "Subtitles by SDI Media Group" | {
"pile_set_name": "OpenSubtitles"
} |
Re: [Gnu-arch-users] corrupted binary files
From:
Brian May
Subject:
Re: [Gnu-arch-users] corrupted binary files
Date:
Tue, 06 Apr 2004 08:53:54 +1000
User-agent:
Gnus/5.1006 (Gnus v5.10.6) Emacs/21.3 (gnu/linux)
>>>>> "David" == David Allouche <address@hidden> writes:
David> Are you sure the cvs-keyword configuration for that file is
David> correct?
How do I tell/verify what the config is for a given file?
David> I have a similar problem with the texmacs cvs. The
David> maintainer is just too lazy and ignorant to correctly set
David> the thing up so binary files have keyword expansion
David> enabled.
David> For some reason, that does not cause any problem with "cvs
David> co" or "cvs update", but it breaks with the command used by
David> cscvs.
David> When adding the "-kb" (disable the damn expansion) option
David> to the "cvs update" command in cscvs, things work right.
Hmmm... That works... Not sure if this is good or bad...
I thought everyone knew these days the importance of using -kb for
binary files in CVS :-(.
--
Brian May <address@hidden> | {
"pile_set_name": "Pile-CC"
} |
1995-2020 Hospitality Net™ All rights reservedHospitality Net is powered by Hsyndicate | {
"pile_set_name": "OpenWebText2"
} |
1. Introduction {#s0005}
===============
Immune cells, like macrophages, are major sources of reactive oxygen species (ROS) in the body. Particularly superoxide is produced by NADPH oxidase (NOX), an enzyme family consisting of several isoforms of which NOX2 is the main isoform expressed in macrophages and neutrophils. The superoxide anion is important for effective host defense, immune cell function and is a component of the cellular redox signaling. However, when overproduction of superoxide persists, the normal redox signaling gets disrupted leading to oxidative stress, in which an imbalance develops between ROS and nitric oxide (NO). Oxidative stress represents a major risk factor and cause of both metabolic and cardiovascular diseases [@bib1]. It can be ameliorated either by a decrease in ROS production or an increase in NO bioavailability. In addition to NO production via the classic nitric oxide synthase (NOS) pathway, fueling the alternative nitrate-nitrite-NO pathway with inorganic nitrate and nitrite has shown beneficial effects in many disorders and experimental disease models via restoring NO bioavailability [@bib2], [@bib3], [@bib4]. However, it is still not clear how this effect is mediated and signaling events may occur in a cell-, tissue- and environment-specific manner. In a recent study, we demonstrated that augmented NOX-mediated ROS production in lipopolysaccharide (LPS)-activated mouse macrophages was almost normalized by simultaneous nitrite treatment [@bib5]. This effect of nitrite on superoxide production was abolished by an NO scavenger and also during inhibition of xanthine oxidoreductase (XOR), which suggests that nitrite acts via an NO signaling mechanism that is dependent on functional XOR.
XOR, a molybdoflavin-containing enzyme responsible for the terminal steps of purine catabolism, catalyzes the hydroxylation of hypoxanthine to xanthine and xanthine to uric acid, which is accompanied by ROS production. However, under certain conditions, XOR is able to use inorganic nitrite as a substrate and generate NO [@bib6], [@bib7]. Especially during low oxygen tensions, which occur during ischemia reperfusion injuries, this way of NO production seems important and may compensate for a compromised NOS function since this enzyme is dependent on oxygen. Immune cells like macrophages are present at sites of tissue injury where they may become lytic and therefore a significant source of XOR.
In addition to activating cGMP-dependent signaling pathways NO can mediate protein S-nitrosation by attachment of an NO^+^ moiety to cysteine residues in proteins. This S-nitrosothiol formation may influence protein function and has been widely recognized as a signaling mechanism [@bib8], [@bib9]. There is emerging evidence that protein S-nitrosation may be altered during disease development, and hence play a role in renal and cardiac protection [@bib10] as well as in modulation of the immune system [@bib11]. The reaction is highly regulated and exhibits remarkable specificity occurring only on selected cysteine residues located within a certain amino acid motif and basic surrounding conditions [@bib12].
In the current study we used murine macrophages to investigate if the previously demonstrated effects of inorganic nitrite on oxidative stress are achieved via XOR-dependent NO production and if NO-mediated S-nitrosation of NOX subunits may contribute to the reduced NOX activity following treatment with inorganic nitrite.
2. Material and methods {#s0010}
=======================
2.1. Materials {#s0015}
--------------
Unless otherwise indicated all chemicals were purchased from Sigma-Aldrich (Stockholm, Sweden).
2.2. Cell culture {#s0020}
-----------------
Mouse peritoneal macrophages (IC-21 ATCC TIB-186; American Type Culture Collection, Manassas, VA, USA) were cultured in RPMI 1640 medium complemented with 10% fetal bovine serum, 2 mmol/l [l]{.smallcaps}-glutamine, 100 units/ml penicillin, and 100 µg/ml streptomycin (all Thermo Fisher Scientific, Stockholm, Sweden) and in humidified air with 5% CO~2~ at 37 °C. Medium was replaced every other day and cells were passaged using Dulbecco\'s phosphate-buffered saline (DPBS, without Ca^2+^/Mg^2+^) when reaching 80--90% confluency. For experiments, macrophages were seeded in plates at a density of 500000 cells/ml and allowed to attach overnight.
2.3. Pharmacological treatments {#s0025}
-------------------------------
Pharmacological treatments of macrophages were performed in RPMI medium without fetal bovine serum. After the normal growth medium was removed, cells were washed once with DPBS. Macrophages were then incubated with sodium nitrite (NaNO~2~, 10 µmol/l), LPS from *Escherichia coli* endotoxin (0111:B4, 10 ng/ml), diethylenetriamine/NO adduct (DETA-NONOate, 0.5 mmol/l), N~ω~-nitro-[l]{.smallcaps}-arginine methylester hydrochloride ([l]{.smallcaps}-NAME, 1 mmol/l), febuxostat (30 nmol/l) or a combination thereof, for 24 h or the indicated times. [l]{.smallcaps}-NAME and febuxostat were added 30 min before treatment with other substances.
To prepare S-nitrosocysteine (CysNO), 1 vol of 200 mmol/l [l]{.smallcaps}-cysteine (in 1 mol/l HCl) was incubated with 1 vol of 200 mol/l sodium nitrite (in distilled water) for 30 min at room temperature in the dark. The solution was neutralized by the addition of 2 volumes of 1 mol/l K~2~HPO~4~ (pH 7.4) buffer and was stored in aliquots at −80 °C until use. The concentration of formed CysNO was determined from the optical absorbance at 338 nm by using the extinction coefficient 900/(mol\*l\*cm) [@bib13]. After LPS-treatment or incubation in serum-free medium for 24 h, macrophages were washed twice with phosphate buffered saline (PBS, containing Ca^2+^/Mg^2+^) followed by incubation with CysNO in PBS for 15 min at 37 °C. Subsequently, cells were washed with PBS twice and collected for Biotin Switch assay (see below).
2.4. NADPH-dependent superoxide production {#s0030}
------------------------------------------
Lucigenin-dependent chemiluminescence was used to determine NADPH oxidase activity, measured as NADPH-dependent superoxide production, as described previously [@bib5]. After pharmacological treatments, macrophages were washed with DPBS and detached from the culture dish by incubation in DPBS at 37 °C for 15 min. Cell suspensions were transferred to measurement tubes and incubated with dark-adapted lucigenin (5 µmol/l) at 37 °C for 15 min. Superoxide production was started by the injection of the NOX substrate NADPH (100 µmol/l) and the chemiluminescence signal was measured every 3 s for 3 min with an AutoLumat LB953 Multi-Tube Luminometer (Berthold Technologies, Bad Wildbad, Germany). Previous studies have demonstrated that incubation with either tempol to scavenge superoxide or VAS3947 to inhibit NOX reduces the chemiluminescence signal with approximately 90% in both cell culture and tissues [@bib14], [@bib15], suggesting that mainly superoxide from NOX is measured. Moreover, unspecific lucigenin-mediated superoxide generation in the absence of added NADPH was similar to the blank (i.e. PBS only), and should therefore not have any significant impact on the results.
2.5. Biotin Switch assay {#s0035}
------------------------
Protein S-nitrosation levels were determined in macrophage lysates using the Biotin Switch assay with some modifications from the original protocol [@bib16]. All steps before the neutravidin-purification of biotinylated proteins were carried out in the dark. After treatments, macrophages were collected and lysed by scraping in TENT buffer (50 mmol/l Tris-HCl pH 7.2, 150 mmol/l NaCl, 1 mmol/l EDTA, 0.1 mmol/l neocuproine, 1% Triton X-100, protease inhibitor cocktail) and incubation on ice for 15 min. The soluble fraction was obtained by centrifugation at 10000 g and 4 °C for 15 min. Protein concentration was determined using the Bradford protein assay (Bio-Rad) and samples were adjusted to 0.5 mg/ml with TEN buffer (TENT without Triton X-100). Free thiols were blocked in 4 volumes of HENS buffer (250 mmol/l Hepes pH 7.7, 1 mmol/l EDTA, 0.1 mmol/l neocuproine, 1% SDS) containing 20 mmol/l *S*-methyl methanethiosulfonate at 50 °C for 30 min with agitation every 5 min. Proteins were precipitated with cold acetone for at least 30 min at −20 °C to remove excess blocking reagent. To reduce SNO-thiols and label resulting SH-residues, precipitated proteins were resuspended in 300 µl HENS/mg protein containing 5 mmol/l ascorbate and incubated in the presence of 1 mmol/l (N-\[6-(Biotinamido)hexyl\]-3′-(2′-pyridyldithio)propionamide (HPDP-biotin, Thermo Fisher Scientific) for 2 h at room temperature. After aceton precipitation, biotinylated proteins were resuspended in 150 µl HENS/mg protein and purified by incubation with NeutrAvidin Plus Ultra Link Resin (Thermo Fisher Scientific) in 5 volumes neutralization buffer (20 mmol/l Hepes pH 7.7, 100 mmol/l NaCl, 1 mmol/l EDTA, 0.5% Triton X-100) over night at 4 °C. Bound proteins were washed extensively (20 mmol/l Hepes pH 7.7, 600 mmol NaCl, 1 mmol/l EDTA, 0.5% Triton X-100), eluted from the resin at 37 °C for 20 min with 1 mmol/l β-mercaptoethanol in 20 mmol/l Hepes pH 7.7, 100 mmol/l NaCl, 1 mmol/l EDTA, and analyzed using Western Blot.
2.6. Real-time PCR {#s0040}
------------------
The mRNA expression levels of NOX subunits and xanthine oxidase (XOR) were determined by real-time PCR. After treatments, macrophages were collected in β-mercaptoethanol containing RLT buffer and total RNA was isolated using the RNeasy Mini Kit (Qiagen, Sollentuna, Sweden) according to the manufacturer\'s instructions. RNA purity and concentration were assessed spectrophotometrically on the Nanodrop ND-1000 (Thermo Fisher Scientific). Equal amounts of RNA were reverse transcribed to cDNA with the High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific). Real-time PCR was performed in 96-well plates in a total reaction volume of 20 µl on an ABI 7500 Real-Time PCR System using Power SYBR Green Master mix (Thermo Fisher Scientific) and gene specific primers ([Table 1](#t0005){ref-type="table"}). Mean x-fold relative gene expression changes were calculated with the ∆∆Ct-method [@bib17], standardizing the results to the housekeeping gene β-actin.
2.7. Western Blot {#s0045}
-----------------
Protein fractions from the Biotin Switch assay (input and eluted proteins) were denaturated in loading buffer (62.5 mmol/l Tris-HCl pH 6.8, 10% glycerol, 2% sodium dodecyl sulfate (SDS), 0.01% bromophenol blue, 0.8% β-mercaptoethanol) at 95 °C for 5 min. Protein expression of NOX subunits was measured by Western Blot in macrophages. Whole cell lysates were prepared by scraping the cells in lysis buffer (10 mmol/l Tris-HCl pH 8, 150 mmol/l NaCl, 5 mmol/l EDTA, 60 mmol/l N-octyl-glucoside, 1% Triton X-100, protease inhibitor cocktail) followed by centrifugation at 10000 g for 15 min. Protein concentration was determined in the soluble fraction using the Bradford protein assay (Bio-Rad, Solna, Sweden) and equal amounts of protein were denaturated in loading buffer at 95 °C for 5 min. Proteins were separated on 4--20% SDS-polyacrylamide gels (Bio-Rad) using electrophoresis and transferred to polyvinylidene difluoride membranes (Bio-Rad). The membranes were blocked in 5% nonfat dry milk containing TBS-T (20 mmol/l Trizma base pH 7.6, 150 mmol/l NaCl, 0.1% Tween-20), followed by incubation with primary antibodies (gp91phox/Nox2, BD Biosciences, Stockholm, Sweden; p67phox, Cell Signaling/BioNordika, Stockholm, Sweden; p22phox, p47phox and XOR, Santa Cruz, Heidelberg, Germany). Primary antibodies were detected using the respective horseradish peroxidase-conjugated goat anti-rabbit or anti-mouse IgG (Cell Signaling). Protein bands were visualized by Clarity Western ECL Substrate (Bio-Rad) and intensities were quantified using densitometry (Image Lab software, Bio-Rad). To ensure equal protein loading, membranes were stripped using Restore™ PLUS Western Blot Stripping Buffer (Thermo Fisher Scientific) and after blocking re-probed with primary antibody against β-actin (Santa Cruz) and anti-mouse IgG. Mean x-fold relative protein expression changes were calculated by standardizing the results to the housekeeping protein β-actin. For the comparison of S-nitrosated proteins between LPS- and LPS+CysNO treated cells, the relative intensity ratio SNO-protein/input was calculated for Nox2 and p22phox, respectively, and is presented in the text (LPS treated groups=1). Since the LPS-treatment strongly affected the expression of the studied proteins and SNO-signals were often weak, quantification of SNO-protein/input seemed arbitrary and was omitted for other between-group comparisons but representative blots are shown instead.
2.8. Uric acid assay {#s0050}
--------------------
Uric acid is the final oxidation end product of purine nucleotide metabolism catalyzed by XOR from xanthine and hypoxanthine. Uric acid levels were measured in macrophage cell culture medium after 24 h treatments as a measure of XOR activity. Samples were incubated with 80 µmol/l Amplex Ultra Red reagent (Thermo Fisher Scientific), 0.8 U/ml horse radish peroxidase and 2 U/ml uricase in 100 mmol/l Tris-HCl pH 7.5 for 30 min at 37 °C. The fluorescence signal was measured in a microplate reader (excitation 530 nm, emission 590 nm) and the concentration of uric acid was calculated from a standard curve on the same plate. To investigate how much of the uric acid is derived from XOR, uric acid levels in culture medium of febuxostat (30 nmol/l) treated macrophages were measured with the same approach. As a control, 2.5 mU/ml purified XOR enzyme was used in a cell-free approach and incubated for 30 min at 37 °C with 32 µmol/l hypoxanthine (Sigma), 80 µmol/l Amplex Ultra Red reagent (Thermo Fisher Scientific), 0.8 U/ml horse radish peroxidase in 100 mmol/l Tris-HCl pH 7.5 with or without 2 U/ml uricase and in the presence of different febuxostat concentrations (3, 30, 300, 3000 nmol/l). The fluorescence signal was measured in a microplate reader (excitation 530 nm, emission 590 nm) and the signal without uricase (representing H~2~O~2~ production) was subtracted from the signal with uricase (resulting in only uric acid-derived fluorescence signal). Results are presented as % inhibition with febuxostat vs. no febuxostat.
2.9. DAF-FM fluorescence {#s0055}
------------------------
The cell-permeable fluorescent NO indicator 4,5-diaminofluorescein-FM diacetate (DAF-FM DA) was used to detect NO production in macrophages. The cells were plated and treated in 96-well plates as described above. After 24 h, the cells were loaded with DAF-FM DA (10 µM) for 45 min at 37 °C. Cells were then washed with DPBS and transferred to a black 96-well plate. The fluorescence signal was measured in a microplate reader (excitation 495 nm, emission 515 nm) and is expressed as the percentage change of the [l]{.smallcaps}-NAME treated cells.
2.10. Statistical analysis {#s0060}
--------------------------
Results are expressed as means±SEM. Statistical analyses were performed using one-way ANOVA followed by Bonferroni\'s multiple comparison test (GraphPad Prism version 5.04, San Diego, CA, USA). A p-value\<0.05 was considered statistically significant.
3. Results {#s0065}
==========
3.1. Nitrite reduces superoxide generation in LPS-activated macrophage {#s0070}
----------------------------------------------------------------------
As has been shown recently [@bib5], 24 h activation of macrophages with LPS resulted in increased NADPH-dependent superoxide production and this was attenuated by simultaneous incubation with nitrite. To mimic a more therapeutic situation with administration of nitrite during ongoing inflammation, macrophages were incubated with LPS for 21 h, then nitrite was added and the cells were incubated for another 3 h. This short time was sufficient for a significant reduction of the superoxide generation even though LPS was still present ([Fig. 1](#f0005){ref-type="fig"}). In control cells, nitrite had no effect on superoxide production independently of the incubation time.
3.2. Nitrite does not alter the gene expression of NOX2 subunits {#s0075}
----------------------------------------------------------------
One possible mechanism how nitrite might mediate this attenuation of NOX-derived superoxide formation is through changes in enzyme expression. Therefore, we investigated gene expression levels of the NOX2 subunits in activated and nonactivated macrophages. Treatment with LPS resulted in a strong induction of Nox2, however p47phox was unchanged and levels of p22phox and p67phox were even decreased. Nitrite had no effect in nonactivated cells and did not alter the expression levels of any of the analyzed subunits when administered together with LPS compared to LPS alone ([Fig. 2](#f0010){ref-type="fig"}A--D).
3.3. Nitrite modulates protein expression of NOX2 subunits in LPS-activated macrophages {#s0080}
---------------------------------------------------------------------------------------
Since mRNA levels do not always reflect the abundance of protein in the cells, we also analyzed the protein expression of NOX2 subunits in activated and nonactivated macrophages. Stimulation of the cells with LPS led to a significant increase of Nox2, p22phox, p47phox and p67phox. Whereas the levels of the membrane bound subunits Nox2 and p22phox were not influenced by the presence of nitrite ([Fig. 3](#f0015){ref-type="fig"}A,B), the expression of the cytosolic subunits p47phox and p67phox was significantly reduced in cells treated with LPS plus nitrite compared with LPS alone ([Fig. 3](#f0015){ref-type="fig"}C,D).
3.4. Nitrite does not mediate S-nitrosation of NOX2 subunits {#s0085}
------------------------------------------------------------
S-nitrosation of cysteine residues has been described as a posttranslational modification which impacts on the activity of many proteins. We therefore investigated if nitrite-derived NO mediates S-nitrosation of the membrane bound NOX2 subunits and thereby contributes to the reduced activity of NOX in LPS-activated macrophages. In cells treated with LPS, a proportion of both Nox2 and p22phox underwent S-nitrosation (relative intensity ratio SNO-protein/input 1 for NOX2 and 1 for p22phox; see methods for details); however, simultaneous incubation with nitrite for 24 h did not increase this proportion (relative intensity ratio SNO-protein/input 0.9 for Nox2 and 0.9 for p22phox). In contrast, a short incubation (15 min) with the NO-donor CysNO resulted in clear S-nitrosation of both Nox2 and p22phox (relative intensity ratio SNO-protein/input 3.3 for Nox2 and 6.5 for p22phox), which demonstrates that these proteins are able to undergo S-nitrosation under certain conditions ([Fig. 4](#f0020){ref-type="fig"}A). The mechanisms and kinetics of the release of NO and other reactive nitrogen species vary between different types of NO-donors depending on their decomposition and the requirement of specific conditions or catalysts [@bib18]. Therefore, macrophages were incubated with the slow-releasing NO-donor DETA-NONOate for 24 h in the presence of LPS, which resulted in a similar level of S-nitrosation of Nox2 compared to nitrite, whereas p22hox was not S-nitrosated ([Fig. 4](#f0020){ref-type="fig"}B). Especially the inducible form of endogenous NO synthases (iNOS) produces high amounts of NO in response to LPS-activation of macrophages. To exclude the possibility that this large amount of iNOS-derived NO would mask an effect of nitrite in the detection of S-nitrosation levels, macrophages were treated with [l]{.smallcaps}-NAME to block all NOS isoforms. However, even during NOS inhibition there were no differences between cells treated with LPS alone and LPS plus nitrite ([Fig. 4](#f0020){ref-type="fig"}C). Taken together, these results indicate that the ability of nitrite to reduce superoxide production during LPS-activation of macrophages is not mediated by S-nitrosation of Nox2 or p22phox.
3.5. The effects of nitrite are dependent on XOR {#s0090}
------------------------------------------------
We have previously demonstrated that inhibition of XOR abolished the effect of nitrite on NOX-mediated superoxide production in LPS-activated macrophages [@bib5]. Since there is evidence implicating XOR in the reduction of nitrite to NO and other bioactive nitrogen species [@bib7], [@bib19], we investigated the role of this enzyme further by measuring its gene and protein expression as well as its activity in macrophages. While mRNA levels of XOR were reduced both upon LPS activation and LPS plus nitrite treatment, the protein expression was not influenced by any of the treatments ([Fig. 5](#f0025){ref-type="fig"}A,B). The levels of uric acid were analyzed in the cell culture medium after 24 h treatment of macrophages as a measure of XOR activity. As a control, uric acid production was measured in the presence of febuxostat and resulted in 50--70% inhibition both in culture medium of febuxostat treated macrophages and using purified XOR enzyme ([Supplemental Figure 1](#s0110){ref-type="sec"}). LPS-activation resulted in an increase in uric acid production compared to nonactivated cells. Simultaneous treatment with nitrite increased uric acid levels even further in activated macrophages, which indicates an induction of XOR activity under these conditions ([Fig. 5](#f0025){ref-type="fig"}C). To examine if this change in XOR activity is relevant for nitrite-derived NO production, we measured DAF-FM fluorescence, after 24 h treatment of the macrophages. As shown previously [@bib5], the increased NO production upon treatment with LPS plus nitrite could not be blocked by NOS-inhibition with [l]{.smallcaps}-NAME. However, additional simultaneous inhibition of XOR with febuxostat significantly reduced the NO production, resulting in control levels and was similar in all other groups ([Fig. 5](#f0025){ref-type="fig"}D). These results strongly suggest that XOR, not through changes in its expression but its activity, is involved in the reduction of nitrite to NO and the subsequent inhibition of NOX-derived superoxide production in activated macrophages.
4. Discussion {#s0095}
=============
We demonstrate here that nitrite-mediated attenuation of NOX-derived superoxide production in LPS-activated macrophages is associated with XOR-dependent NO production. Furthermore, we found that nitrite-mediated reduction of superoxide production does not involve S-nitrosation of the membrane-bound NOX subunits Nox2 and p22phox, but can partially be attributed to changes in protein expression of the cytosolic subunits p47phox and p67phox.
According to current knowledge, phagocytic NADPH oxidase NOX2, which is the main isoform expressed in macrophages, consists of two membrane bound subunits Nox2 (or gp91phox) and p22phox, the cytosolic subunits p47phox, p67phox, p40phox and a small GTPase Rac. The assembly process of the active enzyme complex has been described in detail [@bib20]. Briefly, upon stimulation, p47phox is phosphorylated and translocates, in complex with p67phox and p40phox, to the cell membrane where the active enzyme complex is formed. This results in a burst of superoxide production. Looking at the gene expression of NOX subunits we found a strong induction only of Nox2 mRNA in LPS-activated macrophages. In contrast, the protein levels of all four investigated subunits were significantly increased after LPS stimulation. Interestingly, the simultaneous treatment with nitrite only showed an effect on protein expression and reduced levels of p47phox and p67phox, but not Nox2 and p22phox. If this extent of protein reduction has sufficient impact on the enzyme activity to explain the reduced superoxide production seen with nitrite in LPS-activated macrophages is unclear. In addition to expression levels, also the intracellular distribution of these subunits plays an important role for NOX activity and might be altered by nitrite. However, it has been shown in human neutrophils that only 10--15% of p47phox (in complex with p67phox) translocates to the membrane upon cell activation [@bib21], [@bib22]. Future studies are warranted to investigate if nitrite may influence these translocation processes, and hence contribute to the reduced NOX activity.
Supplementation with both inorganic nitrate and nitrite have shown beneficial effects in various diseases and experimental models, e.g. reduced blood pressure in healthy volunteers [@bib23] and in hypertensive patients [@bib24], [@bib25] and rats [@bib26], reversed features of metabolic syndrome [@bib27] and improved glucose and insulin homeostasis in type 2 diabetes and its complications [@bib28], [@bib29]. In many cases, the protective effects of nitrate and nitrite could be linked to reduced NOX-derived oxidative stress [@bib29], [@bib30], [@bib31]. In the current study, we show a therapeutic effect with nitrite, i.e. administration after 21 h LPS challenge resulted in reduced NOX activity and prevention of oxidative stress. Also in vivo nitrite has shown protective effects not only against LPS- but also against tumor necrosis factor-induced shock in mice [@bib32], however, the effects on NOX were not addressed in that study.
Since nitrite abolished superoxide production by NOX in an NO-dependent manner [@bib5], signaling via NO became of particular interest. There are three principal pathways of physiological NO signaling [@bib33] including the reaction of NO with thiyl radicals to form S-nitrosothiols. S-nitrosation has gained increased recognition as a functionally important posttranslational modification and might provide protection by preventing irreversible oxidative thiol-modifications by ROS or peroxynitrite [@bib34]. This action suggests a potential for nitrite-derived NO to S-nitrosate NOX subunits. Most studies of proteins that have been identified as substrates for S-nitrosation used greatly simplified in vitro preparations and/or relied on exogenous NO donors rather than physiological NO produced by endogenous enzymes. We support here the discrepancy between such conditions since we found that in our experimental conditions nitrite-derived NO did not mediate S-nitrosation of Nox2 and p22phox to a greater extent than incubation of macrophages with LPS alone. However, the presence of the NO donor CysNO resulted in strong S-nitrosation of both proteins. These results indicate that nitrite does not reduce LPS-induced superoxide production in these cells via functional NO-mediated modulation of the membrane-bound NOX subunits. However, non-physiologically high NO concentrations resulted in S-nitrosation of both Nox2 and p22phox. There are studies suggesting S-nitrosation of NOX isoforms and subunits, but in these studies purified proteins and/or NO donors were used [@bib35], [@bib36] and the physiological relevance remains to be proven. The activity of Nox5, an isoform only expressed in humans, has been shown to be reduced via NO-mediated S-nitrosation in transfected COS-7 cells and four cysteine residues have been identified as targets for S-nitrosation [@bib37]. This could be of particular interest for the favorable effects observed with nitrite in humans and future studies investigating the signaling mechanism in humans are warranted.
XOR has been described as damaging during disease conditions like ischemia reperfusion injury or atherosclerotic plaques due to its enhanced affinity for oxygen and concomitant ROS production when performing its generally accepted role in purine catabolism [@bib38], [@bib39]. In addition, the detailed mechanism has been elucidated how XOR can also catalyze the reduction of nitrite to NO using either NADH or xanthine as reducing substrate [@bib40], [@bib41]. Especially during conditions with low oxygen tension, XOR-mediated NO production is fairly high and can compensate for impaired NOS-derived, oxygen-dependent NO synthesis [@bib4]. Also in normoxia XOR has been found to produce NO when nitrite is present as substrate [@bib5], [@bib7], [@bib42]. Nitrite-mediated attenuation of superoxide production in LPS-activated macrophages has been described as XOR-dependent since the effect was abolished in the presence of the XOR inhibitor febuxostat [@bib5]. In this study, we demonstrate that also the NO production in LPS-activated macrophages was dependent on XOR and could be blocked by febuxostat whereas this effect was independent of NOS. We found increased uric acid levels in the cell culture medium, which reflect increased XOR activity and are in agreement with previous findings showing increased XOR activity in human macrophages upon LPS-stimulation [@bib43]. In contrast to other tissue and cell types [@bib44], [@bib45] gene expression of XOR was not increased upon inflammatory stimulation. In the current study we show that protein levels of XOR were not influenced by any of the treatments and the gene expression was even decreased during treatment with LPS and LPS plus nitrite, compared to the observed induction of NOX expression. Therefore we conclude that the elevated XOR activity does not contribute to the observed superoxide levels, but rather that NOX is the main source. On the contrary, the increased uric acid formation might reflect increased nitrite reductase activity of XOR, which leads to increased NO bioavailability and subsequently reduced NOX-derived superoxide. Still, it is unclear how nitrite-derived NO and the reduced NOX activity are connected. Direct scavenging of ROS by NO [@bib5] as well as enzyme modification via S-nitrosation, as shown here, seem unlikely.
In conclusion, we show in LPS-activated macrophages that XOR plays an important role in nitrite reduction to NO, leading to decreased NOX-derived superoxide generation. Reduced NOX activity is however not mediated by any significant NO-dependent S-nitrosation of the membrane-bound NOX subunits Nox2 or p22phox. Instead, our findings suggest that a reduced protein expression of the cytosolic NOX subunits may contribute to the favorable effect of nitrite. These mechanistic details are important to further characterize inorganic nitrate and nitrite as potential therapeutics in ROS-mediated cardiovascular and metabolic diseases.
Conflict of interests {#s0100}
=====================
Lundberg and Weitzberg are co-inventors on patent applications related to the therapeutic use of inorganic nitrate.
Appendix A. Supplementary material {#s0110}
==================================
Supplementary material.
We thank Annika Olsson, Carina Nihlen and Annette Ebberyd (Dept of Physiology and Pharmacology, Karolinska Institutet) for their excellent technical contribution. This work was supported by grants from the Swedish Research Council (M.C., E.W. & J.O.L) (Dnr 521-2011-2639), the Swedish Heart and Lung Foundation (M.C. & J.O.L) (Dnr: 20110589 & 20140448), Stockholm City Council (ALF, Dnr 2014-2015) and by KID-funding from the Karolinska Institutet (M.C) (Dnr 2415/2012-225 and Dnr 2-3707/2013).
Supplementary data associated with this article can be found in the online version at [doi:10.1016/j.redox.2016.09.015](http://dx.doi.org/10.1016/j.redox.2016.09.015){#ir0005}.
{#f0005}
{#f0010}
{#f0015}
{#f0020}
![Role of XOR in the effects mediated by nitrite. Relative mRNA (A) and protein levels (B) of XOR are presented as fold change of nonactivated control macrophages. Uric acid concentration in macrophage culture medium as a measure of XOR activity is given in µmol/l (C). NO production was measured as DAF-FM fluorescence and is presented as % of the [l]{.smallcaps}-NAME treated macrophages. Data are shown as mean±SEM, n=6/group (A,C), n=4/group (B), n=8/group (D), \* p\<0.05 between indicated groups.](gr5){#f0025}
######
Nucleotide-sequences of primers used in real-time PCR.
Table 1
Gene Forward primer (5′−3′) Reverse primer (5′−3′)
------------- --------------------------- ---------------------------
*Nox2* GCACCTGCAGCCTGCCTGAATT TTGTGTGGATGGCGGTGTGCA
*p22phox* CTGGCGTCTGGCCTGATTCTCATC CCGAAAAGCTTCACCACAGAGGTCA
*p47phox* CAGCCATGGGGGACACCTTCATT GCCTCAATGGGGAACATCTCCTTCA
*p67phox* AAGACCTTAAAGAGGCCTTGACGCA TCGGACTTCATGTTGGTTGCCAA
*XOR* CAGCATCCCCATTGAGTTCA GCATAGATGGCCCTCTTGTTG
*β*-*actin* GCTCCTCCTGAGCGCAAT GTGGACAGTGAGGCCAGGAT
| {
"pile_set_name": "PubMed Central"
} |
End of preview. Expand
in Data Studio
README.md exists but content is empty.
- Downloads last month
- 6