Instructions to use Marks-lab/LOL-EVE with libraries, inference providers, notebooks, and local apps. Follow these links to get started.
- Libraries
- Transformers
How to use Marks-lab/LOL-EVE with Transformers:
# Use a pipeline as a high-level helper from transformers import pipeline pipe = pipeline("text-generation", model="Marks-lab/LOL-EVE", trust_remote_code=True)# Load model directly from transformers import AutoModelForCausalLM model = AutoModelForCausalLM.from_pretrained("Marks-lab/LOL-EVE", trust_remote_code=True, dtype="auto") - Notebooks
- Google Colab
- Kaggle
- Local Apps Settings
- vLLM
How to use Marks-lab/LOL-EVE with vLLM:
Install from pip and serve model
# Install vLLM from pip: pip install vllm # Start the vLLM server: vllm serve "Marks-lab/LOL-EVE" # Call the server using curl (OpenAI-compatible API): curl -X POST "http://localhost:8000/v1/completions" \ -H "Content-Type: application/json" \ --data '{ "model": "Marks-lab/LOL-EVE", "prompt": "Once upon a time,", "max_tokens": 512, "temperature": 0.5 }'Use Docker
docker model run hf.co/Marks-lab/LOL-EVE
- SGLang
How to use Marks-lab/LOL-EVE with SGLang:
Install from pip and serve model
# Install SGLang from pip: pip install sglang # Start the SGLang server: python3 -m sglang.launch_server \ --model-path "Marks-lab/LOL-EVE" \ --host 0.0.0.0 \ --port 30000 # Call the server using curl (OpenAI-compatible API): curl -X POST "http://localhost:30000/v1/completions" \ -H "Content-Type: application/json" \ --data '{ "model": "Marks-lab/LOL-EVE", "prompt": "Once upon a time,", "max_tokens": 512, "temperature": 0.5 }'Use Docker images
docker run --gpus all \ --shm-size 32g \ -p 30000:30000 \ -v ~/.cache/huggingface:/root/.cache/huggingface \ --env "HF_TOKEN=<secret>" \ --ipc=host \ lmsysorg/sglang:latest \ python3 -m sglang.launch_server \ --model-path "Marks-lab/LOL-EVE" \ --host 0.0.0.0 \ --port 30000 # Call the server using curl (OpenAI-compatible API): curl -X POST "http://localhost:30000/v1/completions" \ -H "Content-Type: application/json" \ --data '{ "model": "Marks-lab/LOL-EVE", "prompt": "Once upon a time,", "max_tokens": 512, "temperature": 0.5 }' - Docker Model Runner
How to use Marks-lab/LOL-EVE with Docker Model Runner:
docker model run hf.co/Marks-lab/LOL-EVE
LOL-EVE: A Genomic Language Model for Zero-Shot Prediction of Promoter Variant Effects
Model Description
LOL-EVE is a transformer-based model that processes DNA sequences with control codes to predict variant effects. The model was trained on 13.6 million mammalian promoter sequences and demonstrates state-of-the-art performance on promoter indel prediction tasks.
Key Features
- Large vocabulary: 39,378 tokens including DNA bases, control codes, and special tokens
- Control code integration: Incorporates gene, species, and clade information
- Protein context: Uses pre-trained ESM embeddings for gene-specific understanding
- Flexible input format: Supports both basic DNA sequences and control code sequences
- Zero-shot prediction: Enables prediction of indel effects without task-specific training
Usage
Basic Usage
from transformers import AutoTokenizer, AutoModelForCausalLM
# Load model and tokenizer
tokenizer = AutoTokenizer.from_pretrained('Marks-lab/LOL-EVE')
model = AutoModelForCausalLM.from_pretrained('Marks-lab/LOL-EVE', trust_remote_code=True)
# Basic DNA sequence
sequence = "[MASK] [MASK] [MASK] [SOS]ATGCTAGCTAGCTAGCTAGCTA[EOS]"
inputs = tokenizer(sequence, return_tensors="pt")
outputs = model(**inputs)
With Control Codes (Recommended)
# Control code sequence (recommended)
control_sequence = "brca1 human primate [SOS] ATGCTAGCTAGCTAGCTAGCTA [EOS]"
inputs = tokenizer(control_sequence, return_tensors="pt")
outputs = model(**inputs)
Variant Scoring
import pandas as pd
import torch
def score_variants_hf(variants_df, gene, species, clade):
"""
Score variants using the Hugging Face model.
Args:
variants_df: DataFrame with columns ['sequence', 'variant_sequence']
gene: Gene name (e.g., 'brca1')
species: Species name (e.g., 'human')
clade: Clade information (e.g., 'primate')
Returns:
DataFrame with added 'score' column
"""
scores = []
for _, row in variants_df.iterrows():
# Create control code sequences
ref_seq = f"{gene} {species} {clade} [SOS] {row['sequence']} [EOS]"
var_seq = f"{gene} {species} {clade} [SOS] {row['variant_sequence']} [EOS]"
# Tokenize sequences
ref_inputs = tokenizer(ref_seq, return_tensors="pt")
var_inputs = tokenizer(var_seq, return_tensors="pt")
# Get model outputs
with torch.no_grad():
ref_outputs = model(**ref_inputs)
var_outputs = model(**var_inputs)
# Calculate log-likelihood scores
ref_logits = ref_outputs.logits[0, :-1] # Exclude last token
var_logits = var_outputs.logits[0, :-1]
ref_tokens = ref_inputs['input_ids'][0, 1:] # Exclude first token
var_tokens = var_inputs['input_ids'][0, 1:]
# Calculate sequence likelihood
ref_score = torch.nn.functional.cross_entropy(ref_logits, ref_tokens, reduction='sum')
var_score = torch.nn.functional.cross_entropy(var_logits, var_tokens, reduction='sum')
# Score is the difference (higher = more deleterious)
score = (var_score - ref_score).item()
scores.append(score)
variants_df['score'] = scores
return variants_df
# Example usage
variants = pd.DataFrame({
'sequence': ['ATGCTAGCTAGCTAGCTAGCTA', 'ATGCTAGCTAGCTAGCTAGCTA'],
'variant_sequence': ['ATGCTAGCTAGCTAGCTAGCTA', 'ATGCTAGCTAGCTAGCTAGCTA'] # Example variants
})
scored_variants = score_variants_hf(variants, gene='brca1', species='human', clade='primate')
print(scored_variants)
Input Format
The model expects sequences in the format:
gene species clade [SOS] sequence [EOS]
Where:
gene: Gene name (e.g., "brca1", "tp53")species: Species name (e.g., "human", "mouse")clade: Clade information (e.g., "primate", "mammal")[SOS]: Start of sequence tokensequence: DNA sequence (A, T, G, C)[EOS]: End of sequence token
Model Architecture
- Model type: Causal Language Model (CTRL-based)
- Layers: 12 transformer layers
- Hidden size: 768 dimensions
- Attention heads: 12
- Vocabulary size: 39,378 tokens
- Max sequence length: 1,007 tokens
- Position embeddings: Adaptive local position embeddings
Training Data
The model was trained on genomic sequences with:
- DNA sequences up to 1000 base pairs
- Gene-specific control codes
- Species and clade information
- Pre-trained ESM protein embeddings
- 13.6 million mammalian promoter sequences
Performance
LOL-EVE demonstrates state-of-the-art performance on:
Benchmarks
- Ultra-rare variant prioritization: Prioritizing ultra-rare variants in gnomAD
- Causal eQTL identification: Identifying causal expression quantitative trait loci
- Transcription factor binding site disruption: Analyzing TFBS disruption by indels
Datasets
- LOL-EVE-UltraRare - Ultra-rare variant benchmark dataset
- LOL-EVE-eQTL_benchmark - eQTL benchmark dataset
- PromoterZoo Training Data - PromoterZoo Training Data
Citation
If you use LOL-EVE in your research, please cite:
@article{loleve2025,
title={A Genomic Language Model for Zero-Shot Prediction of Promoter Variant Effects},
author={[Authors]},
journal={MLCB 2025},
year={2025}
}
License
This model is released under the MIT License. See the LICENSE file for more details.
Repository
- GitHub: https://github.com/debbiemarkslab/LOL-EVE
- Paper: MLCB 2025 version coming end of month! (link to be updated)
Contact
For questions or issues, please contact [your-email@domain.com] or open an issue on the GitHub repository.
- Downloads last month
- 16