LOL-EVE: A Genomic Language Model for Zero-Shot Prediction of Promoter Variant Effects

Model Description

LOL-EVE is a transformer-based model that processes DNA sequences with control codes to predict variant effects. The model was trained on 13.6 million mammalian promoter sequences and demonstrates state-of-the-art performance on promoter indel prediction tasks.

Key Features

  • Large vocabulary: 39,378 tokens including DNA bases, control codes, and special tokens
  • Control code integration: Incorporates gene, species, and clade information
  • Protein context: Uses pre-trained ESM embeddings for gene-specific understanding
  • Flexible input format: Supports both basic DNA sequences and control code sequences
  • Zero-shot prediction: Enables prediction of indel effects without task-specific training

Usage

Basic Usage

from transformers import AutoTokenizer, AutoModelForCausalLM

# Load model and tokenizer
tokenizer = AutoTokenizer.from_pretrained('Marks-lab/LOL-EVE')
model = AutoModelForCausalLM.from_pretrained('Marks-lab/LOL-EVE', trust_remote_code=True)

# Basic DNA sequence
sequence = "[MASK] [MASK] [MASK] [SOS]ATGCTAGCTAGCTAGCTAGCTA[EOS]"
inputs = tokenizer(sequence, return_tensors="pt")
outputs = model(**inputs)

With Control Codes (Recommended)

# Control code sequence (recommended)
control_sequence = "brca1 human primate [SOS] ATGCTAGCTAGCTAGCTAGCTA [EOS]"
inputs = tokenizer(control_sequence, return_tensors="pt")
outputs = model(**inputs)

Variant Scoring

import pandas as pd
import torch

def score_variants_hf(variants_df, gene, species, clade):
    """
    Score variants using the Hugging Face model.
    
    Args:
        variants_df: DataFrame with columns ['sequence', 'variant_sequence']
        gene: Gene name (e.g., 'brca1')
        species: Species name (e.g., 'human')
        clade: Clade information (e.g., 'primate')
    
    Returns:
        DataFrame with added 'score' column
    """
    scores = []
    
    for _, row in variants_df.iterrows():
        # Create control code sequences
        ref_seq = f"{gene} {species} {clade} [SOS] {row['sequence']} [EOS]"
        var_seq = f"{gene} {species} {clade} [SOS] {row['variant_sequence']} [EOS]"
        
        # Tokenize sequences
        ref_inputs = tokenizer(ref_seq, return_tensors="pt")
        var_inputs = tokenizer(var_seq, return_tensors="pt")
        
        # Get model outputs
        with torch.no_grad():
            ref_outputs = model(**ref_inputs)
            var_outputs = model(**var_inputs)
            
            # Calculate log-likelihood scores
            ref_logits = ref_outputs.logits[0, :-1]  # Exclude last token
            var_logits = var_outputs.logits[0, :-1]
            
            ref_tokens = ref_inputs['input_ids'][0, 1:]  # Exclude first token
            var_tokens = var_inputs['input_ids'][0, 1:]
            
            # Calculate sequence likelihood
            ref_score = torch.nn.functional.cross_entropy(ref_logits, ref_tokens, reduction='sum')
            var_score = torch.nn.functional.cross_entropy(var_logits, var_tokens, reduction='sum')
            
            # Score is the difference (higher = more deleterious)
            score = (var_score - ref_score).item()
            scores.append(score)
    
    variants_df['score'] = scores
    return variants_df

# Example usage
variants = pd.DataFrame({
    'sequence': ['ATGCTAGCTAGCTAGCTAGCTA', 'ATGCTAGCTAGCTAGCTAGCTA'],
    'variant_sequence': ['ATGCTAGCTAGCTAGCTAGCTA', 'ATGCTAGCTAGCTAGCTAGCTA']  # Example variants
})

scored_variants = score_variants_hf(variants, gene='brca1', species='human', clade='primate')
print(scored_variants)

Input Format

The model expects sequences in the format:

gene species clade [SOS] sequence [EOS]

Where:

  • gene: Gene name (e.g., "brca1", "tp53")
  • species: Species name (e.g., "human", "mouse")
  • clade: Clade information (e.g., "primate", "mammal")
  • [SOS]: Start of sequence token
  • sequence: DNA sequence (A, T, G, C)
  • [EOS]: End of sequence token

Model Architecture

  • Model type: Causal Language Model (CTRL-based)
  • Layers: 12 transformer layers
  • Hidden size: 768 dimensions
  • Attention heads: 12
  • Vocabulary size: 39,378 tokens
  • Max sequence length: 1,007 tokens
  • Position embeddings: Adaptive local position embeddings

Training Data

The model was trained on genomic sequences with:

  • DNA sequences up to 1000 base pairs
  • Gene-specific control codes
  • Species and clade information
  • Pre-trained ESM protein embeddings
  • 13.6 million mammalian promoter sequences

Performance

LOL-EVE demonstrates state-of-the-art performance on:

Benchmarks

  • Ultra-rare variant prioritization: Prioritizing ultra-rare variants in gnomAD
  • Causal eQTL identification: Identifying causal expression quantitative trait loci
  • Transcription factor binding site disruption: Analyzing TFBS disruption by indels

Datasets

Citation

If you use LOL-EVE in your research, please cite:

@article{loleve2025,
  title={A Genomic Language Model for Zero-Shot Prediction of Promoter Variant Effects},
  author={[Authors]},
  journal={MLCB 2025},
  year={2025}
}

License

This model is released under the MIT License. See the LICENSE file for more details.

Repository

Contact

For questions or issues, please contact [your-email@domain.com] or open an issue on the GitHub repository.

Downloads last month
16
Inference Providers NEW
This model isn't deployed by any Inference Provider. 🙋 Ask for provider support