HuggingFaceBio/Carbon-500M-GGUF

Carbon-500M GGUF

Available files

Quant	File	Size
BF16	carbon-500m-bf16.gguf	982.2 MB
Q8_0	carbon-500m-q8_0.gguf	524.6 MB
Q6_K	carbon-500m-q6_k.gguf	443.2 MB
Q5_K_M	carbon-500m-q5_k_m.gguf	405.1 MB
Q4_K_M	carbon-500m-q4_k_m.gguf	369.2 MB

K-quants are produced with --token-embedding-type Q8_0 --output-tensor-type Q8_0 so the sensitive embedding/output tensors stay at Q8_0 precision (important for this model's tight DNA-vs-text logit margins).

How to use

Click Use this model > llama.cpp on this page for a ready-made snippet. To install llama.cpp, follow llama.app or download a prebuilt binary from the releases page.

Carbon-500M is a base DNA model, not a chat model, so use text completion rather than the chat UI. Start the prompt with <dna>:

llama completion -hf HuggingFaceBio/Carbon-500M-GGUF:Q8_0 -p '<dna>ATGCGCTAGCTACGATCGATCGTAGCTAGCTAGCTAGCTACG' -n 128 --temp 0

llama serve -hf HuggingFaceBio/Carbon-500M-GGUF:Q8_0 serves the same model over HTTP; send raw prompts to its /completion endpoint.

Carbon-500M shares its vocabulary with Carbon-3B and Carbon-8B, so it works as their draft model for speculative decoding: add -hfd HuggingFaceBio/Carbon-500M-GGUF:Q8_0 when running either of them.

See also

• Source weights: HuggingFaceBio/Carbon-500M
• Other GGUF variants: 500M · 3B · 8B

License

Apache-2.0, inherited from the source model.